ID: 1056556656

View in Genome Browser
Species Human (GRCh38)
Location 9:87695222-87695244
Sequence GCCTAAGCAGCCAGCTTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056556651_1056556656 10 Left 1056556651 9:87695189-87695211 CCAATTTCTGGGTACCAGAACTT 0: 1
1: 0
2: 2
3: 12
4: 142
Right 1056556656 9:87695222-87695244 GCCTAAGCAGCCAGCTTTGGAGG No data
1056556653_1056556656 -4 Left 1056556653 9:87695203-87695225 CCAGAACTTTCCATGCTTGGCCT 0: 1
1: 0
2: 1
3: 15
4: 152
Right 1056556656 9:87695222-87695244 GCCTAAGCAGCCAGCTTTGGAGG No data
1056556645_1056556656 26 Left 1056556645 9:87695173-87695195 CCCCACACTCCAAGAGCCAATTT 0: 1
1: 0
2: 2
3: 13
4: 170
Right 1056556656 9:87695222-87695244 GCCTAAGCAGCCAGCTTTGGAGG No data
1056556650_1056556656 17 Left 1056556650 9:87695182-87695204 CCAAGAGCCAATTTCTGGGTACC 0: 1
1: 0
2: 1
3: 7
4: 98
Right 1056556656 9:87695222-87695244 GCCTAAGCAGCCAGCTTTGGAGG No data
1056556647_1056556656 24 Left 1056556647 9:87695175-87695197 CCACACTCCAAGAGCCAATTTCT 0: 1
1: 0
2: 2
3: 23
4: 324
Right 1056556656 9:87695222-87695244 GCCTAAGCAGCCAGCTTTGGAGG No data
1056556646_1056556656 25 Left 1056556646 9:87695174-87695196 CCCACACTCCAAGAGCCAATTTC 0: 1
1: 0
2: 2
3: 9
4: 205
Right 1056556656 9:87695222-87695244 GCCTAAGCAGCCAGCTTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056556656 Original CRISPR GCCTAAGCAGCCAGCTTTGG AGG Intronic
No off target data available for this crispr