ID: 1056558212

View in Genome Browser
Species Human (GRCh38)
Location 9:87707134-87707156
Sequence AGCAGGGCGTGGAGGGGGCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 905
Summary {0: 1, 1: 0, 2: 12, 3: 78, 4: 814}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056558212_1056558225 12 Left 1056558212 9:87707134-87707156 CCCAGCCCCCTCCACGCCCTGCT 0: 1
1: 0
2: 12
3: 78
4: 814
Right 1056558225 9:87707169-87707191 CACCTACCCTGAGAGCACAGTGG 0: 1
1: 0
2: 1
3: 15
4: 214
1056558212_1056558226 13 Left 1056558212 9:87707134-87707156 CCCAGCCCCCTCCACGCCCTGCT 0: 1
1: 0
2: 12
3: 78
4: 814
Right 1056558226 9:87707170-87707192 ACCTACCCTGAGAGCACAGTGGG 0: 1
1: 0
2: 0
3: 9
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056558212 Original CRISPR AGCAGGGCGTGGAGGGGGCT GGG (reversed) Exonic
900103060 1:971022-971044 ATCAGGGTGGGGAGGGGGGTGGG - Intronic
900119086 1:1041000-1041022 AGCGGGGCTGGGAGGGGCCTGGG + Intronic
900119124 1:1041075-1041097 AGCGGGGCTGGGAGGGGCCTGGG + Intronic
900131809 1:1090421-1090443 AGCTGGGCCTGGAGGGGACACGG + Exonic
900221429 1:1511549-1511571 TGCGGGGCGTGGACGGGGCCGGG - Intergenic
900308750 1:2023491-2023513 AGCCAGGCGTGGAGGAGGCCTGG + Intronic
900312662 1:2041689-2041711 ACCAGGGCGTGGACTGGCCTGGG - Intergenic
900336961 1:2169189-2169211 AGGTGGGAGTGGAGGTGGCTTGG - Intronic
900365325 1:2309776-2309798 AGGAGGGGGTGGGGGGGGCCGGG - Exonic
900427671 1:2587854-2587876 AGCAGGGAGAGGAGGTGGCAGGG - Intronic
900482941 1:2908147-2908169 AGCAGGGCGGGGAGGGAGCTGGG - Intergenic
900867345 1:5277743-5277765 CGCAGTGTGTGGATGGGGCTTGG + Intergenic
901289996 1:8116655-8116677 TGTGGGGCGTGGAGGGGCCTTGG - Intergenic
901422420 1:9160196-9160218 AGCAGGGAGAAGAGGGGGCGTGG - Intergenic
901479990 1:9518615-9518637 GGCAGGGTGTGGTGGGGGCGGGG - Intergenic
901696536 1:11012280-11012302 GGCGGGGCCTGGAGGGGGCGGGG - Intergenic
901913418 1:12479132-12479154 AGCAAGGCCTGGAGTGGCCTGGG + Intronic
902214256 1:14924486-14924508 AGCAGTGCGTGGACGCGGCGGGG + Intronic
902448845 1:16484295-16484317 AGCAGGCCGGGGAGGGGCCTCGG + Intergenic
902505924 1:16939058-16939080 AGCAGGCCGGGGAGGGGCCTCGG - Exonic
902795024 1:18795495-18795517 AGCAAGGCAGGGAGGGGGATGGG - Intergenic
902894372 1:19468749-19468771 AGGAGGGCATGGCGGGTGCTGGG - Intronic
903066457 1:20702413-20702435 AGGAGGGAGTGGGGGAGGCTCGG - Intronic
903154913 1:21436725-21436747 AGCAGGCCGGGGAGGGGCCTCGG - Intergenic
903542558 1:24105165-24105187 CTCAGGGCTTGAAGGGGGCTGGG - Intronic
903883991 1:26530614-26530636 GGCAGGGCGTGGGGGGACCTTGG + Intronic
903907729 1:26697547-26697569 AGCTGAGTGGGGAGGGGGCTGGG + Intronic
904031258 1:27534815-27534837 TGCAGGGGGTGTAGGGGGCAGGG + Exonic
904041317 1:27586762-27586784 AGCAGGGCTTGGAGTGCCCTGGG - Intronic
904042438 1:27592571-27592593 AGCAGGGCCTGGGGGGGGGAGGG - Intronic
904106374 1:28088460-28088482 AGCACAGCGTGAAGGGGGATGGG - Intronic
904364503 1:30001809-30001831 AGCAAGCCCAGGAGGGGGCTGGG - Intergenic
904383888 1:30129403-30129425 GGCAGGGGGTGGAGGAGGCGGGG + Intergenic
904449597 1:30602320-30602342 AGAAGGGAGTGGATGGGGCAGGG - Intergenic
904617121 1:31755967-31755989 AGCAGGGCCTGGGTGGGGCGGGG - Intronic
905368556 1:37469938-37469960 AGCATGGTGTGGAGGGGGCAGGG + Intergenic
906083128 1:43107495-43107517 GGCAGGGGGTGGTGGGGGGTAGG + Intergenic
906320672 1:44813533-44813555 AGCAGGGGGTACAGGGCGCTGGG + Intronic
906345167 1:45010399-45010421 GGCGGGACGTGAAGGGGGCTCGG - Intronic
907118734 1:51990620-51990642 GGGAGGGCGCGGAGGGGGCCGGG + Exonic
907183091 1:52587887-52587909 AGCAGGACGTGGGCGGGGCGGGG - Intergenic
907300540 1:53483950-53483972 AGCAGGGGCAGGAGGGGCCTGGG + Intergenic
909448558 1:75774011-75774033 AGCAGGGTATGAAGGGAGCTTGG - Intronic
909512967 1:76475854-76475876 AGCGGGGCCTGTCGGGGGCTGGG - Intronic
910406541 1:86897160-86897182 AGCTGGGCGTGGTGGCGGGTGGG + Intronic
910775237 1:90868162-90868184 ACCAGGGCCTGTTGGGGGCTGGG + Intergenic
912232851 1:107815875-107815897 GGCGGGGTGTGGAGGGGGCATGG + Intronic
912502522 1:110131470-110131492 AGCAGGCAGTGGAGGGGGTTAGG + Intergenic
912514533 1:110209945-110209967 AGCTTGGCGGGGAGGGGGCGAGG + Intergenic
912568626 1:110606465-110606487 CCCAGGGCGGGGAGGGGTCTGGG + Intronic
912576921 1:110680601-110680623 AGAAGGGCTTGGAGGGGGAATGG - Intergenic
912627730 1:111220200-111220222 GGGAGGGCTTGGAGGGGGCTTGG - Intronic
912819247 1:112854101-112854123 AGCAGGACGTGGGTGGGGCCAGG - Intergenic
913335178 1:117703224-117703246 TGGAGGGCGGGGAGGGGGCAGGG + Intergenic
913966529 1:143381643-143381665 GGAAGGGTGTGGATGGGGCTGGG + Intergenic
914060904 1:144207250-144207272 GGAAGGGTGTGGATGGGGCTGGG + Intergenic
914118246 1:144759119-144759141 GGAAGGGTGTGGATGGGGCTGGG - Intergenic
914196692 1:145451509-145451531 ATCTGTGTGTGGAGGGGGCTGGG - Intergenic
914845479 1:151281576-151281598 GGGAGGGCGTGGACGGGGCACGG - Exonic
914942774 1:152037218-152037240 AGGACGGGGTGGAGGGGGCCGGG - Intronic
915088446 1:153404897-153404919 ACCAGGGCGAGGTGGGTGCTCGG + Intergenic
915253462 1:154607628-154607650 AGCAGTGCGTGAAGAGGGCTTGG - Intronic
915355160 1:155251469-155251491 AGCACGGCTTGGGGCGGGCTGGG - Intronic
916062517 1:161109903-161109925 AGCTGGGCGTGGTGGGGGGAGGG + Intronic
916792588 1:168136954-168136976 GGCCGGGCGTGGGGGGGGCGGGG - Intronic
918066505 1:181105320-181105342 AGCAGGCCCAGGCGGGGGCTGGG + Intergenic
918108537 1:181434701-181434723 AGCAGGGAGCGCAGGGGGTTTGG + Intronic
918156771 1:181855052-181855074 ACCAGGGCCTGTTGGGGGCTGGG + Intergenic
918332140 1:183471509-183471531 AGCCGGGCGTGGAGAGGGCTGGG - Intergenic
918563528 1:185898168-185898190 AACAGGACTTGGATGGGGCTGGG + Intronic
918946383 1:191070857-191070879 ACCAGGGCCTGTTGGGGGCTGGG + Intergenic
919586097 1:199442321-199442343 AGCAGGGCCTGTTGGGGGTTAGG - Intergenic
919779568 1:201213289-201213311 GGCAGGGAGTGGAAGAGGCTGGG + Exonic
919825820 1:201502405-201502427 GGCAGAGAGAGGAGGGGGCTGGG + Intronic
919916868 1:202144373-202144395 AGCAGGGCGCGGCGCGGGCGGGG + Intronic
920057953 1:203206267-203206289 AGGAGGGAGTGGGTGGGGCTGGG + Intergenic
920178313 1:204117039-204117061 AGCAGGGTGTGGTTAGGGCTGGG + Intronic
920298178 1:204972514-204972536 AGCAGAGGCTGGAGAGGGCTGGG - Intronic
920534391 1:206728368-206728390 AGCAGGGGGTGAAGGGGCTTCGG - Intronic
920911533 1:210222377-210222399 AGTAGGGAGTGGAGGAAGCTGGG - Intergenic
920912736 1:210233214-210233236 AGCTGGGCGCGGAGGCGGCGCGG + Intronic
921023858 1:211259784-211259806 AGCGGCGAGGGGAGGGGGCTGGG - Intronic
921053402 1:211526901-211526923 AGGATGGGGTGGAGGGGGCAAGG - Intergenic
921306097 1:213798461-213798483 AGCAGGGGCTGGAGGCGGATAGG + Intergenic
922081813 1:222304948-222304970 AGCAGGGGCTGAAGGGGGCATGG - Intergenic
922582543 1:226709534-226709556 AGCAGGCTGTGGAGGGGACTAGG + Intronic
922755999 1:228097277-228097299 AGCAGGGAGTGGGCTGGGCTGGG + Intronic
922789421 1:228302900-228302922 AGCAGGGCCTTGTGTGGGCTGGG + Intronic
923420546 1:233810628-233810650 AGCTGGGCGTGGTGGGGGGGGGG - Intergenic
923586206 1:235274234-235274256 AGCTGGGCGTGGTGGTGGCTTGG + Intronic
924603579 1:245513131-245513153 AGGAGGGTGTGGAGGAGGGTGGG - Intronic
1063604116 10:7508025-7508047 GGCAGGAAGTCGAGGGGGCTCGG + Intergenic
1063964854 10:11338925-11338947 AGCAGGGTGAGGATGGGGGTGGG - Intergenic
1063979894 10:11444679-11444701 AGCCGGGTGTGCAGGGGGCAGGG - Intergenic
1064239063 10:13608365-13608387 AGCAGGTCGGGGAGCGGGCCTGG - Intronic
1065227167 10:23556092-23556114 GGCAGGGAGTGGTGGGGGATGGG + Intergenic
1065970119 10:30799372-30799394 TGCAGGCCGTGCTGGGGGCTGGG + Intergenic
1067242653 10:44509274-44509296 AGGAGTGCATAGAGGGGGCTGGG + Intergenic
1067285116 10:44902240-44902262 AGAAGGGCAGGGAGGGGGCAGGG + Intergenic
1067426854 10:46217184-46217206 TGCAGGATGTGGAGGGTGCTGGG + Intergenic
1067574861 10:47402768-47402790 GGCAGGGCTGGGAGAGGGCTGGG + Intergenic
1067716942 10:48697264-48697286 AGCAGGTCGGGAAGGGAGCTGGG - Intronic
1068197150 10:53731669-53731691 AGCAGGGCCTGTTGGGGGATGGG + Intergenic
1068427695 10:56888992-56889014 ATCAGGGCCTGTTGGGGGCTGGG - Intergenic
1068593383 10:58874262-58874284 AGCAGGCCGTGAAGCAGGCTCGG + Intergenic
1068694645 10:59953725-59953747 ACCAGGGCCTGTCGGGGGCTTGG - Intergenic
1068718408 10:60214516-60214538 ACCAGGGCCTGTTGGGGGCTGGG - Intronic
1069058354 10:63867685-63867707 AGCAGGGCTTGGGGTAGGCTTGG + Intergenic
1069307004 10:66983248-66983270 AACATGGCTGGGAGGGGGCTAGG - Intronic
1069557782 10:69408871-69408893 GGCGGGGCCTGGAGGGGGCGGGG - Intronic
1069955047 10:72044805-72044827 AGCTGGGTGGGGAGGGGGCTGGG - Intergenic
1070307139 10:75246327-75246349 AGCAGGGAGTGGTGGGGGCTGGG - Intergenic
1070675641 10:78409681-78409703 GTCAGGGAGTGGAGGGGGCAGGG - Intergenic
1070775528 10:79107689-79107711 AGCAGGGCTTGCAGGGGGCAGGG + Intronic
1070824484 10:79382802-79382824 AGCATGGCCTGGAGGAGGCGTGG + Exonic
1071046039 10:81378659-81378681 AGCAGGGCCTGTTGGGGGATGGG + Intergenic
1071068710 10:81667261-81667283 AGCCGGGCGTGGTGGCGGGTGGG + Intergenic
1071450240 10:85786855-85786877 GGCAGGGCGTGGAGGAGGGGTGG + Intronic
1071760284 10:88596627-88596649 AGCAGGGTGTGGAGATGGTTTGG - Intronic
1071997536 10:91162934-91162956 AGCGGCGCGGGGCGGGGGCTGGG - Intergenic
1072008886 10:91286417-91286439 AGCAGGGTTTGTAGGGGGATTGG - Intergenic
1072686075 10:97537741-97537763 TGCAGGGGATGGAGGGAGCTGGG - Intronic
1073051055 10:100667725-100667747 GGCAGGGCGTGGGGGGTGATGGG + Intergenic
1073303835 10:102487433-102487455 AGCCGGGCATGGTGGGGGGTGGG + Intronic
1074866823 10:117549054-117549076 AGCAGGACGACGGGGGGGCTGGG + Exonic
1075664003 10:124218004-124218026 ACCAGGGAGGGGAGGAGGCTAGG - Intergenic
1075687004 10:124371260-124371282 AGCAGGGAGTGGGGAGAGCTGGG - Intergenic
1075793574 10:125103235-125103257 AGGGGGGTGTGGAGTGGGCTGGG - Intronic
1076000691 10:126910722-126910744 AGAAAGGCGTGGAGGGAGGTAGG - Intronic
1076083806 10:127607291-127607313 AGCAAGGGCAGGAGGGGGCTGGG - Intergenic
1076351364 10:129816905-129816927 AGCAGGGCAAGCAGTGGGCTTGG + Intergenic
1076352427 10:129826159-129826181 AGCAGGTGGTGGTGGGGTCTTGG + Intergenic
1076529666 10:131136038-131136060 AGCATGGTGGGGAGGGGGCAGGG - Intronic
1076696334 10:132249132-132249154 GTCAGGGCGTGCAGGGGGCGGGG + Intronic
1076696341 10:132249148-132249170 GGCGGGGCGTGCAGGGGGCGGGG + Intronic
1076809434 10:132878947-132878969 AGCAGGACAAGGAGGGGGGTGGG + Intronic
1076837074 10:133026445-133026467 AGCAGGGCAGTGAGTGGGCTGGG - Intergenic
1076847329 10:133075683-133075705 AGCAGGGCTGGCAGGAGGCTGGG + Intronic
1076886392 10:133264730-133264752 AGCCGGGCGTGGAGGTAGATGGG - Intronic
1076886408 10:133264810-133264832 AGCCGGGCGTGGAGGTAGGTGGG - Intronic
1076886451 10:133265008-133265030 AGCCGGGCGTGGAGGTAGATGGG - Intronic
1076886460 10:133265048-133265070 AGCTGGGCGTGGAGGTAGATGGG - Intronic
1076886486 10:133265167-133265189 AGCTGGGCGTGGAGGTAGATGGG - Intronic
1076886495 10:133265207-133265229 AGCTGGGCGTGGAGGTAGATGGG - Intronic
1076994111 11:289991-290013 AGCCGGACGTTGAGGGGGCTGGG - Exonic
1077021956 11:420890-420912 CGCAGGGGGCGGAGGGGCCTGGG + Intronic
1077024383 11:432776-432798 TGCGGGGCCTGGATGGGGCTGGG + Intronic
1077093589 11:790135-790157 AGGAGGGCGGGGAGGGGGAGGGG + Intergenic
1077145159 11:1041310-1041332 TGCTGGGCCTGGAGGTGGCTGGG + Intergenic
1077152381 11:1078051-1078073 CGGAGGGCTTGGAGGGGGCAGGG + Intergenic
1077258875 11:1604826-1604848 AGCATGGTGTGGAAGGGGCCAGG - Intergenic
1077284250 11:1758813-1758835 AGCAGGGTGAGGAGGGGTCTGGG - Intronic
1077318296 11:1928911-1928933 GGGAGGGGGTGGAAGGGGCTGGG - Intronic
1077361137 11:2140578-2140600 AGTGGGGCGGGCAGGGGGCTGGG - Intronic
1077406034 11:2382952-2382974 AGCTGGTCCTGGAAGGGGCTTGG + Intronic
1077416287 11:2425770-2425792 AGCACAGGGTGTAGGGGGCTTGG + Intergenic
1077419686 11:2444590-2444612 AGGTGGGCGGGGAGGGGGCGGGG + Intergenic
1077419707 11:2444650-2444672 AGGTGGGCGAGGAGGGGGCGGGG + Intergenic
1077436166 11:2540191-2540213 AGCAGCCTGGGGAGGGGGCTGGG + Intronic
1077501146 11:2910220-2910242 AGCAGGAGGTGGAGTGGGGTGGG + Intronic
1077538772 11:3136720-3136742 ACATAGGCGTGGAGGGGGCTGGG - Intronic
1077540051 11:3142419-3142441 AGCAGGGCATGGAGGGGTCGTGG - Intronic
1077543765 11:3160029-3160051 GCCAGGGCAGGGAGGGGGCTGGG - Intronic
1077609868 11:3637485-3637507 AGCAGGAAGCAGAGGGGGCTGGG + Intergenic
1077655074 11:4010873-4010895 ACCAGGGCCTGTTGGGGGCTGGG - Intronic
1077889048 11:6405567-6405589 AGCAGGGCTGGGAGTGGGCGTGG + Intronic
1077902605 11:6501635-6501657 AGCAGGGCTTGCATGGGGTTAGG + Intronic
1078055080 11:8002774-8002796 AACAGGGAGTGGAGGAGGCAGGG - Intergenic
1078915433 11:15774531-15774553 AGCAGGGATTGTGGGGGGCTTGG - Intergenic
1079249796 11:18779124-18779146 AGCAGGGTGTGGCAGGAGCTAGG - Intronic
1079250007 11:18780418-18780440 AGCAGGGTGTGGCAGGAGCTAGG - Intronic
1079690250 11:23407990-23408012 ACCAGGGCCTGTAGGGGGATAGG - Intergenic
1079985936 11:27201031-27201053 AGGTGGAGGTGGAGGGGGCTGGG - Intergenic
1080372814 11:31672042-31672064 AGAAGGTCGATGAGGGGGCTGGG + Intronic
1080435660 11:32239868-32239890 AGCCGGGCGTGGAGTGGGGGTGG + Intergenic
1081565397 11:44257904-44257926 AGCAGGGCGTGGAGTGGTGGTGG - Intergenic
1081655658 11:44855790-44855812 GGCAGGGCATGGTGGGGGGTGGG - Intronic
1081685568 11:45040795-45040817 AGCAGTAGGTGGAGGGGGATTGG - Intergenic
1081709663 11:45208740-45208762 AGGAGGGTGTGGTGGGGGCCAGG + Intronic
1081766231 11:45612299-45612321 GGCAAGGAGAGGAGGGGGCTTGG - Intergenic
1081814634 11:45931703-45931725 CCCAGGGCCTGGAGTGGGCTTGG + Intronic
1081937742 11:46917130-46917152 GGCAGGGCGTGGAGATGTCTAGG - Intronic
1081994523 11:47355054-47355076 AGCGGGATGTGGAGGGGGCCTGG + Exonic
1082083895 11:48033272-48033294 AGCTGGGGGTGGAGTGGGGTGGG + Intronic
1082951846 11:58825303-58825325 ACCAGGGCCTGTCGGGGGCTGGG - Intergenic
1083252118 11:61475192-61475214 AGCGGGGCATGGAGGGGAGTCGG - Intronic
1083672595 11:64307337-64307359 AGGAGGATGGGGAGGGGGCTGGG + Exonic
1083783929 11:64933243-64933265 AGCAGTGAGTGTTGGGGGCTGGG + Exonic
1083936458 11:65872433-65872455 AGCGGGCAGTGGCGGGGGCTGGG - Intronic
1083945243 11:65919650-65919672 GGGAGGGCATGGAGGGGGCGGGG - Intronic
1083989372 11:66237441-66237463 AGCAGGGAGAGCAGGGAGCTAGG - Intronic
1084184353 11:67463932-67463954 GGCAGTGGGTGGAGGGGGCTGGG + Exonic
1084196417 11:67525384-67525406 AGCTGGGTGGGGAGTGGGCTGGG - Intergenic
1084259253 11:67964010-67964032 AGCAGGATGTGGATGGGGCCAGG + Intergenic
1084323937 11:68388360-68388382 ACCAGGGCTAGGAGGGGCCTTGG - Intronic
1084433301 11:69123353-69123375 GTGAGGGCGGGGAGGGGGCTGGG + Intergenic
1084802661 11:71555202-71555224 AGCACGGTGTGGAAGGGGCCAGG + Intronic
1084891285 11:72238274-72238296 AGGAGGACTTGGAGGAGGCTGGG + Exonic
1085273507 11:75283834-75283856 AGCAGGGAGTTGTGGGGGCAGGG + Intronic
1086865243 11:91972272-91972294 AGCAGGGCGTGGGGGTGGGGCGG - Intergenic
1087064335 11:94012861-94012883 AGCAGGGCAGGGAGAGTGCTGGG + Intergenic
1087290669 11:96316959-96316981 ACCAGAGTGGGGAGGGGGCTTGG - Intronic
1089344912 11:117784986-117785008 AGTAGGGTTTGGAGAGGGCTTGG - Intronic
1090393976 11:126407051-126407073 AGCAGGGCATGGAGCGAGCTGGG + Intronic
1090813436 11:130268236-130268258 AGCGGGGGGTGGAGTGGGGTAGG + Intronic
1090895528 11:130970905-130970927 ACCAGGGCCTGTAGGGGGCATGG - Intergenic
1090988397 11:131794113-131794135 AGAAGGGAATGAAGGGGGCTTGG + Intronic
1091180866 11:133603357-133603379 AGCAGGGGGTGGAGGGGAAGAGG + Intergenic
1091237987 11:134034347-134034369 AGCAGGGCCTGGCCGGGGATGGG + Intergenic
1091445474 12:542343-542365 GGCAGGGAGAGGAGGGGGCAGGG - Intronic
1091460569 12:641310-641332 AGCAGGAGGTGGAGGGGGTTGGG - Intronic
1091599448 12:1908986-1909008 AGCAGGGCAGGGACGCGGCTGGG - Intronic
1091664920 12:2412062-2412084 AGGTGGGCATGGGGGGGGCTTGG - Intronic
1092155434 12:6278923-6278945 AGGAGGGCGCGGACGGGGCGGGG - Intergenic
1092262545 12:6960250-6960272 AGCAGGGCCTGGGGGGGGGGGGG + Intronic
1092913808 12:13171756-13171778 TAAAGGGTGTGGAGGGGGCTAGG - Intergenic
1093091814 12:14930001-14930023 ACCAGGGCCTGTAGGGGGATAGG + Intronic
1093716168 12:22384482-22384504 ACCAGGGCCTGTTGGGGGCTAGG + Intronic
1095695331 12:45137509-45137531 ACCAGGGCCTGTTGGGGGCTGGG + Intergenic
1095875993 12:47080123-47080145 CGCAGAGCGGGGAGGGGGCAGGG + Intronic
1096101372 12:48972261-48972283 CGCAGGGCTTGGAGGAGGGTGGG - Intergenic
1096242952 12:49969074-49969096 GGCAGGGCGAGTAGAGGGCTTGG - Intronic
1096499106 12:52054742-52054764 AGCTGGGCGTGGAGGGCGACGGG - Exonic
1096571975 12:52528780-52528802 AGCAGGGCATGGTGGGGGCGGGG - Intergenic
1096660147 12:53119109-53119131 CCCAGGGCCTGGAGGGGGCATGG - Exonic
1097269784 12:57766900-57766922 AGCTGGGCGTAGAGGGGCCTGGG + Exonic
1097383385 12:58921093-58921115 AGCTGGGCGGGGTGGGGGATGGG + Intergenic
1097747669 12:63317629-63317651 ACCTGGGAGTGGAGGGGGCGGGG + Intergenic
1099975614 12:89542804-89542826 AGCCTGGCTTGGAGGGGCCTGGG + Intergenic
1100407056 12:94280876-94280898 AGCAGAGCAAGGAGGGGGCCTGG + Intronic
1100567367 12:95810171-95810193 ACCAGGGCCTGTTGGGGGCTTGG - Intronic
1101032124 12:100671065-100671087 AGCAGGGGGAGGAGGTGGCAGGG + Intergenic
1101086647 12:101243014-101243036 AGCAGGGGGTGGAGGGGACTGGG + Intergenic
1101382037 12:104221926-104221948 AGCAGGGAGTGGTGGAGACTGGG + Intronic
1101436544 12:104669228-104669250 AGGAGGGCGTGGAGCTGGCGGGG - Intronic
1102101410 12:110281456-110281478 AAGAGAGCGGGGAGGGGGCTCGG + Intronic
1102247152 12:111362804-111362826 AGGCGGTGGTGGAGGGGGCTCGG + Exonic
1102455605 12:113069240-113069262 AGCAGGAAGTGGAGGGGGAGGGG - Intronic
1102533704 12:113565619-113565641 AGCGGGGAATGGAGGGCGCTGGG + Intergenic
1102589989 12:113949779-113949801 GGCAGGGATTGGAGGAGGCTTGG - Intronic
1103069723 12:117931244-117931266 AACAGGGCGTGGACTGGGCTAGG - Intronic
1103556886 12:121771731-121771753 AGCAGGCAGTGCTGGGGGCTGGG - Intronic
1103698676 12:122836016-122836038 CGCCGGGGGTCGAGGGGGCTGGG + Intronic
1103862752 12:124027490-124027512 AGCAGGAGGTGGTGGTGGCTCGG - Intronic
1103867343 12:124063632-124063654 AGCTGAGCATGGAGGGTGCTGGG - Intronic
1103983176 12:124750036-124750058 AGCGGGGCGGGGAGGGGGCTTGG + Intergenic
1104072240 12:125355983-125356005 AGTGGGGTTTGGAGGGGGCTGGG + Intronic
1104854119 12:131894331-131894353 AGCGGGGCGGGGAAGGGGCGGGG + Intergenic
1104973780 12:132543016-132543038 CGAAGAGCCTGGAGGGGGCTTGG - Intronic
1105344570 13:19561079-19561101 AGGAGGATGGGGAGGGGGCTGGG - Intergenic
1105941722 13:25153403-25153425 AGCAGGGCGAAGAGGAGGCCTGG + Intergenic
1107684783 13:42885989-42886011 AGCTGGGCGTGGTGGCGGGTGGG + Intergenic
1108068295 13:46601700-46601722 AGCAGGGCTTGGAAGGTGATTGG - Intronic
1108199056 13:48024773-48024795 ACCAGGGCCTGTCGGGGGCTGGG + Intergenic
1108751491 13:53452438-53452460 AGCAGGGGGTGGTGCTGGCTGGG + Intergenic
1109087796 13:57998589-57998611 ACCAGGGCCTGTTGGGGGCTGGG - Intergenic
1109282791 13:60376436-60376458 AGCAGGGCCTGTTGGGGGATGGG + Intergenic
1109958135 13:69595361-69595383 AGCAGGGTGAGGAGGGAGCAAGG + Intergenic
1110426585 13:75374166-75374188 GGCAGGGCCTGGCGTGGGCTGGG - Intronic
1110540579 13:76702422-76702444 ACCAGGGCCTGTTGGGGGCTGGG + Intergenic
1110983492 13:81934098-81934120 ACCAGGGCGTGGTAGGGGTTGGG + Intergenic
1113709436 13:112454015-112454037 GGCAGGGCAGGGAGGGGACTAGG + Intergenic
1113813072 13:113154013-113154035 CGCAGGGCGTGGGGGAGGCGGGG + Intergenic
1113813078 13:113154029-113154051 GGCGGGGCGTGGAGGAGGCGGGG + Intergenic
1113813128 13:113154134-113154156 CGCAGGGCGTGGGGGAGGCGGGG + Intergenic
1113847892 13:113402927-113402949 AGCAGGGCATGGTGGGGTGTGGG + Intergenic
1114660506 14:24340546-24340568 AGCTGGTCGTGCAGGTGGCTGGG + Intergenic
1115193162 14:30768688-30768710 AGCAGAGTGTGGAGAGGGCCTGG - Intergenic
1116235970 14:42279887-42279909 ACCAGGGCGTGATGGGGGGTGGG - Intergenic
1116331843 14:43606462-43606484 ACCAGGGCCTGTTGGGGGCTGGG + Intergenic
1116624542 14:47247789-47247811 ATCAGGGAGTGGGGGGTGCTAGG - Intronic
1117169758 14:53081904-53081926 AGAAGGGAGAGGAGGGGGATGGG + Intronic
1117360411 14:54967343-54967365 AGCAGGGCGTGGAAGGGTTGGGG + Exonic
1118719304 14:68582986-68583008 ACCAGGGCCTGTAAGGGGCTAGG + Intronic
1119129780 14:72161221-72161243 ACCAGGGCCTGTTGGGGGCTGGG + Intronic
1119262737 14:73247159-73247181 AGGAGGGGCTGGAAGGGGCTTGG + Intronic
1121118650 14:91361573-91361595 AGCACTGAGTGGAGGGGGGTTGG - Intronic
1121253676 14:92516659-92516681 AGCTGGGAGTGCAAGGGGCTGGG + Intronic
1121273309 14:92651933-92651955 AGCAGGGAGCACAGGGGGCTGGG - Exonic
1121300024 14:92862784-92862806 GGCAGGGTGTGGAGTGGGGTGGG - Intergenic
1121534371 14:94681159-94681181 AGCAGGGTGTGTTGGAGGCTTGG + Intergenic
1121955023 14:98205797-98205819 GGGAGGGCGTGGAGGTGGATGGG - Intergenic
1122053790 14:99078609-99078631 AGCAGGGCCTGGAGGGGGTCCGG - Intergenic
1122145296 14:99685085-99685107 AGCTGGGGGTGGGGGGGGGTTGG - Intronic
1122155133 14:99746297-99746319 AGCTGGGTGTGGCGGTGGCTTGG + Intronic
1122434091 14:101680902-101680924 ACCAGGGCCTGTTGGGGGCTGGG - Intergenic
1122605937 14:102947851-102947873 GGCAGGGCGTGGGAGGGCCTTGG - Intronic
1122664083 14:103316836-103316858 GGCGGGGCGTGAAGGTGGCTGGG - Intergenic
1122698529 14:103570847-103570869 AGGAAGGGGTGGAGGTGGCTAGG + Intronic
1122811523 14:104291735-104291757 AGCGAGGCCTGGAGGGTGCTGGG - Intergenic
1122838371 14:104442482-104442504 AGGAGGGCTCGGAGGAGGCTTGG - Intergenic
1122915237 14:104855339-104855361 AGCAGGGAGTGGAGGGTGAAGGG + Intergenic
1122919256 14:104873317-104873339 TGCAGGCAGGGGAGGGGGCTTGG + Intronic
1122947749 14:105020922-105020944 TGCAGGGCGCGGAGGAGCCTGGG - Intronic
1122955559 14:105069002-105069024 AGCAGAAAGTGGAAGGGGCTGGG - Intergenic
1122959724 14:105088867-105088889 TGCGGGGAGTGGTGGGGGCTGGG - Intergenic
1202943630 14_KI270726v1_random:6669-6691 ACCAGGGCCTGTAGGGGGGTTGG - Intergenic
1123630266 15:22256275-22256297 CCCAAGGTGTGGAGGGGGCTGGG + Intergenic
1124110487 15:26781223-26781245 AGCAGGACGTGGGTGGGGCCAGG - Intronic
1124412964 15:29451780-29451802 AGCAGGACTTGCAGGGGGGTGGG - Intronic
1124956252 15:34362498-34362520 ACAGGGGCGTGGAGGGGGCGAGG - Intronic
1124956422 15:34363425-34363447 AGCTGGGCATGGAGGGGTCCTGG - Exonic
1125937393 15:43648865-43648887 AGCGGGGCGGGGCGGGGCCTAGG - Intronic
1126113408 15:45188030-45188052 CGCCGGGCGGGGAGGGGGCGGGG + Intronic
1126619561 15:50623483-50623505 GGCGGGGCGGGGAGGGGGCGGGG - Intronic
1127349488 15:58136287-58136309 AGAGGGGATTGGAGGGGGCTTGG - Intronic
1127447208 15:59076159-59076181 AGAGGGCTGTGGAGGGGGCTGGG - Exonic
1127842375 15:62842532-62842554 AGCAGAGGGTGGGGTGGGCTGGG - Exonic
1128099836 15:64989729-64989751 CGCGGGCCGTGGAGGCGGCTGGG + Exonic
1128160744 15:65421774-65421796 GGCAGGGCTGGGAGGGGGATGGG - Intronic
1128323374 15:66707506-66707528 AGCCGGGCAGGGCGGGGGCTTGG - Intronic
1128649976 15:69403678-69403700 AGAAGGGCTTGGAGGTGGCCAGG - Exonic
1128771938 15:70289443-70289465 AACAGGGAGTGGTGGGGACTGGG - Intergenic
1128943183 15:71805178-71805200 AGCAGGGAGTGGAAGGTGCAGGG - Intronic
1129312522 15:74722626-74722648 AGCAGGAGGTTGAGGAGGCTGGG + Exonic
1129590693 15:76912344-76912366 AGCTGGGCGTGGTGGCGGGTGGG - Intergenic
1129660860 15:77552178-77552200 AGCAGGGTGTGGCCCGGGCTTGG - Intergenic
1129709600 15:77813877-77813899 GGCAGGGTGGGGAGGGCGCTGGG - Intronic
1129853657 15:78810169-78810191 AGAAGGGCGTGGAGGGAGTGGGG - Intronic
1131030775 15:89184534-89184556 AGCAGTGAGTGGGGAGGGCTGGG + Intronic
1131499239 15:92945540-92945562 AGCCGGGCGTGGTGGGGGTGGGG - Intronic
1131674293 15:94655276-94655298 AGCAAGGGGTGGCGGGGGCATGG + Intergenic
1132036215 15:98487032-98487054 AGCAGGGCTTGGAGATGCCTGGG - Intronic
1202971380 15_KI270727v1_random:241745-241767 AGCAGCGGGTGGGGGGGGGTTGG + Intergenic
1132497702 16:271506-271528 AGCTGGGAGTGGAGGGTGCCAGG - Intronic
1132659466 16:1054986-1055008 AGCAGAGAGTGGGTGGGGCTGGG + Intergenic
1132669104 16:1095431-1095453 GGCAGGGCCTGCAGGGGCCTCGG + Intronic
1132755567 16:1482892-1482914 AGCGGGGCGTGGGGTGGGGTGGG - Intergenic
1133140043 16:3736948-3736970 AGCTGGGTGTGGTGGGGGCAAGG + Intronic
1133230953 16:4366257-4366279 AGCAGGGCGGGGTGGCAGCTGGG + Intronic
1133231769 16:4370331-4370353 AGCAGGGAGTGGTGGGGACTGGG + Intronic
1133236124 16:4388183-4388205 AGCAGGGCTTGGAGTGGGGGTGG + Intronic
1133242865 16:4425973-4425995 GGGAGGGCGTGGTGGGGGCATGG + Exonic
1133938129 16:10285062-10285084 AACAGGCCGTGGACTGGGCTGGG - Intergenic
1134005912 16:10818688-10818710 CGCAGGCTGGGGAGGGGGCTCGG + Exonic
1134128145 16:11630401-11630423 AGCAGGGCCTGCGGGAGGCTGGG - Intronic
1135073791 16:19375761-19375783 AGCAGGTGGTGGAAGAGGCTAGG - Intergenic
1135643344 16:24140510-24140532 GGCAGGGAGAGGAGGTGGCTAGG + Intronic
1136020858 16:27438891-27438913 GGCAGGGCATGGAAGGGCCTGGG + Intronic
1136024738 16:27462250-27462272 AGCAGGGTGTGGAGGCGGCTGGG - Intronic
1136181309 16:28554267-28554289 AGGAGGGCGGGGCCGGGGCTCGG + Intronic
1136639634 16:31552714-31552736 TCCAGAGCCTGGAGGGGGCTGGG - Intergenic
1136659336 16:31742315-31742337 ACCAGGGCCTGGTGGGGGCTGGG - Intronic
1138104814 16:54282368-54282390 AAGAGGGCGCGGAGGGGGCGCGG + Intergenic
1138205082 16:55118774-55118796 GGCAGGGGGTGGAGGGGACCAGG - Intergenic
1138247565 16:55479071-55479093 AGGAGGGCGAGTAGGGGGGTGGG + Exonic
1138332620 16:56227233-56227255 AGCAGGGAATGGAGGAGGCCAGG - Intronic
1139576768 16:67847001-67847023 AGCACGCCGGGGCGGGGGCTGGG + Intronic
1139949279 16:70661288-70661310 AGGATGGTGTGGAGGGGGCGGGG + Exonic
1140034199 16:71360184-71360206 GGCAGGGTGTGGAGGTGGCTGGG + Intronic
1140188774 16:72796871-72796893 AGCAATGCGTGGAGGGAGCATGG + Exonic
1140766655 16:78165612-78165634 AGCAGAGCCTGAAGGGGGCTGGG + Intronic
1141141849 16:81501527-81501549 AGCTGGGGGTGGAGTGGGGTCGG + Intronic
1141443276 16:84042848-84042870 GGCCGGGCCTGCAGGGGGCTGGG - Intergenic
1141503270 16:84459319-84459341 TGCATGGCGTTGAGGGGGCTGGG - Exonic
1141636058 16:85314474-85314496 TGCAGGGCTTGGAGGTGGCCAGG + Intergenic
1141806756 16:86347109-86347131 AGCAGGACAGGAAGGGGGCTGGG - Intergenic
1141972820 16:87494368-87494390 CCCAAGGTGTGGAGGGGGCTGGG - Intergenic
1142007287 16:87695520-87695542 TGCAGGGCGTGGTGGGGGTGGGG + Intronic
1142145004 16:88489217-88489239 AGCAGGGCGACGTGGGTGCTGGG + Intronic
1142194050 16:88731498-88731520 AGCAGAGCCTGGAGGGGGCCAGG + Intronic
1142285967 16:89171690-89171712 AGGGGGGCGGGGAGGGGGCGGGG - Intergenic
1142582301 17:949695-949717 AGCAGGGAGAGGAGGAGGCAGGG - Intronic
1142761281 17:2043172-2043194 AGCAGTGAGTGGAGGGTCCTGGG - Exonic
1142863424 17:2776844-2776866 AGGAGGAGGAGGAGGGGGCTGGG + Intergenic
1143179059 17:4973074-4973096 TGCAGGGAGTGGGGTGGGCTGGG - Intronic
1143341278 17:6213330-6213352 AGCAAGGCGGGAAGGGGCCTTGG - Intergenic
1143563699 17:7709269-7709291 TGCTGGGCGTGGCAGGGGCTGGG + Exonic
1143632368 17:8146532-8146554 AGCAGGGCTTGGGGTGGGCAGGG + Intronic
1143707425 17:8708563-8708585 AGCAGCTAGTAGAGGGGGCTGGG + Intergenic
1143759496 17:9090806-9090828 GGCAGGGCCTTGAGGAGGCTTGG + Intronic
1144218058 17:13074385-13074407 AGAGGGGAGTGGAGGGGGGTGGG - Intergenic
1144686285 17:17228293-17228315 AGCAGTGCTGGCAGGGGGCTGGG - Intronic
1144739313 17:17572383-17572405 AGCAGGACGGAGAGGTGGCTGGG - Intronic
1144816510 17:18039246-18039268 GGCGCGGCGTGGAGGGGGCGGGG - Intergenic
1144879597 17:18424522-18424544 AGCAGTGCTTGCAGGGGCCTGGG + Intergenic
1145152643 17:20519865-20519887 AGCAGTGCTTGCAGGGGCCTGGG - Intergenic
1145251074 17:21297344-21297366 AGCAGGGAGTGGCGGGTGGTGGG + Intronic
1145251759 17:21300662-21300684 AGCAGGGCCTGGAGGCAGCTGGG + Intronic
1145900485 17:28487716-28487738 TGCTGGGGGAGGAGGGGGCTGGG + Intronic
1145906907 17:28521383-28521405 AGGAGGTGGTGCAGGGGGCTTGG - Intronic
1147267584 17:39244261-39244283 AGCAGGAGGAGGAGGGGGCCAGG - Intergenic
1147402988 17:40192091-40192113 TGCATGGCTTGTAGGGGGCTGGG - Intronic
1147420383 17:40319522-40319544 AGCAGGGGGTGGGGGGGTCGGGG - Intronic
1147924525 17:43938443-43938465 AGCGGGGGGTGGGGGGGGCGCGG + Intronic
1147976973 17:44253409-44253431 AGGAGGGGGTGGAGGAGGCAGGG - Intronic
1148683350 17:49487005-49487027 AGCAGGGCCTGGAGGCTGGTGGG - Intergenic
1148691293 17:49528446-49528468 CCCTGTGCGTGGAGGGGGCTGGG - Intergenic
1148841967 17:50504638-50504660 ACAAAGGCCTGGAGGGGGCTGGG - Intergenic
1148863973 17:50619052-50619074 AGAAGGGTGTGGAGGGTGGTGGG + Intronic
1149626554 17:58084018-58084040 AAGAGGGGGTGGAGAGGGCTCGG + Intronic
1150289035 17:63971257-63971279 GGTAGGGGGTGGAGGGGGGTGGG + Intronic
1150556883 17:66262645-66262667 ACCAGGGTGTGGAGGTGGATTGG - Intergenic
1151448314 17:74181602-74181624 CCCAGGGTGGGGAGGGGGCTTGG - Intergenic
1151511792 17:74565223-74565245 AGCAGAGAGTTGATGGGGCTGGG - Intergenic
1151511912 17:74566003-74566025 AGGGGGGCGGGGAGGGGGCGGGG + Intergenic
1151560597 17:74867588-74867610 AGCAGGACAGGGAGGGGGCACGG + Intronic
1151565399 17:74894538-74894560 AGCAGTGCGGGGTGGGGGCCTGG - Intergenic
1151660648 17:75516424-75516446 AGGAGGGCGCAGAGCGGGCTGGG + Intronic
1151668449 17:75558642-75558664 GGCTGGGAGTGGAAGGGGCTGGG - Intronic
1151820349 17:76493593-76493615 AGCAGAGGGGAGAGGGGGCTGGG + Intronic
1151987879 17:77555804-77555826 AGGACAGAGTGGAGGGGGCTCGG - Intergenic
1152115819 17:78386444-78386466 AGGAGGAAGTGGTGGGGGCTGGG - Intronic
1152196022 17:78918853-78918875 AGCTGGGCGTGGTGGCTGCTTGG + Intronic
1152240565 17:79158731-79158753 AGCAGGGCATGGAGGTGGCCAGG + Intronic
1152281107 17:79385276-79385298 AGCAGGGCGGGGAGGCTGCAAGG + Intronic
1152382514 17:79949400-79949422 AGCAGGGCCTGGAGGGGTGAAGG - Intronic
1152416579 17:80166652-80166674 AACAGTGCGTGCAGTGGGCTGGG - Intergenic
1152580748 17:81164710-81164732 GGCAGGGGGTGGAGGAGGCTTGG - Intronic
1152596340 17:81239488-81239510 AGCCGCGCGGGGAGGTGGCTGGG + Intronic
1152696651 17:81800915-81800937 AGCTGGGAATGGAGGGGGCAGGG - Intergenic
1152781825 17:82230184-82230206 AGCGTGGTGTGGAGGCGGCTGGG + Intronic
1152899653 17:82933053-82933075 CGCAGGGCCTGAAGGGGCCTCGG + Intronic
1153020452 18:623985-624007 ATCTCGGCATGGAGGGGGCTGGG + Intronic
1153250733 18:3119118-3119140 AGTGGGGCGAGGATGGGGCTGGG - Intronic
1154213697 18:12400173-12400195 ACCAGGGAGTGGAGGGAGCATGG - Intergenic
1155206202 18:23560338-23560360 AGCAGGAGGAGGTGGGGGCTGGG + Exonic
1155310622 18:24519228-24519250 ACCGGGGGGTGGAGGGGGCCAGG - Intergenic
1155441153 18:25864125-25864147 AGCAGAGCGTGGAGGTGCCATGG + Intergenic
1156449585 18:37259356-37259378 AGCAGGGAGGGGTGGGGGCAAGG + Intronic
1156452507 18:37274732-37274754 GGCGGGGCGTGGCGGGTGCTGGG + Intronic
1157026404 18:43849494-43849516 ATCAGGGCCTGTAGGGGGGTGGG - Intergenic
1157175361 18:45446920-45446942 AGCAGGGTGGGGAGGGGGAGAGG - Intronic
1157199947 18:45651604-45651626 AGCAGGGTGTGGAGGCCGGTTGG + Intronic
1158064910 18:53394997-53395019 AGCTGGGCGTGGTGGGGGGGCGG + Intronic
1158718206 18:59899642-59899664 AGCTGGGAGTGGCGGGAGCTGGG - Intergenic
1159119311 18:64150813-64150835 ACCAGGGCGTGTCGGGGGGTTGG - Intergenic
1159941391 18:74411682-74411704 GCCAGGGCGGGGAGGGGGATGGG - Intergenic
1160390476 18:78527633-78527655 TGGTGGGCGTGGAGGGGCCTGGG - Intergenic
1160726728 19:620836-620858 AGCAGGACGGGCAGGGGGCGCGG + Intronic
1160730985 19:641683-641705 TGCAGGGCGAGGAAGGGGCCAGG + Intronic
1160836681 19:1127809-1127831 TCCAGTGCGTGGAGGGGCCTTGG - Intronic
1160944162 19:1633458-1633480 AGCAGGGAGGGCAGGGGGCGGGG - Intronic
1161007076 19:1942051-1942073 AGCAGGGGGTGGTGGGGGGGAGG + Intronic
1161123725 19:2544533-2544555 AGCTGGGCGTGGTGGGGGTGGGG - Intronic
1161238765 19:3210478-3210500 AGCAGGGAGAGGTGGGGGCGTGG + Intergenic
1161252108 19:3285856-3285878 CGCTGGGCGGGGAGGGGGCGGGG - Intronic
1161285264 19:3465121-3465143 AGTGGGGGGTGGAGGGGGCGAGG - Intronic
1161307885 19:3577620-3577642 AGCGGGGCGTGGGGAGGGATGGG - Intronic
1161327281 19:3669970-3669992 GGCAGGCCGGGGAGGGGCCTGGG + Intronic
1161393054 19:4031337-4031359 AGCAGGACGTGGAGGGTGAGGGG + Intronic
1161395650 19:4043693-4043715 CCCAGGGGGTGGAGGGGGCCAGG - Intergenic
1161399567 19:4061368-4061390 CGCTGGGCGGGGAGGGGGCGGGG - Intronic
1161627790 19:5337274-5337296 AGCGGGGCGTGGAGAGAGTTCGG - Intronic
1161849591 19:6731566-6731588 GGGAGGGAGGGGAGGGGGCTGGG + Intronic
1162139544 19:8577505-8577527 AGCTGGGTGTGGAGGGGGGCGGG + Exonic
1162438820 19:10680231-10680253 AGCTGGGTGTGGATGGGGCGCGG + Intronic
1162444313 19:10712894-10712916 GGCAGGGCATGGAGGGGACAGGG + Intronic
1162728919 19:12706051-12706073 AGCAGGGCGAGGGCGGGGCCGGG + Intronic
1163034935 19:14564754-14564776 AGCAGGGCAGGGATGGGACTTGG - Intronic
1163584859 19:18157952-18157974 GCCAGGGCTGGGAGGGGGCTGGG + Intronic
1163714966 19:18868249-18868271 TGCAGGGGGTGGAGGGTGCTGGG + Intergenic
1164432090 19:28197532-28197554 AGATGGGCGTGGTGGGGGGTGGG - Intergenic
1164458863 19:28430824-28430846 AGCAGGGAGTGGTGGGAACTGGG - Intergenic
1164588003 19:29489349-29489371 AGCAGGGCTTGCATTGGGCTGGG - Intergenic
1164611070 19:29632061-29632083 AGCAGGGCCTGGTGGTGGCCTGG - Intergenic
1164658504 19:29942177-29942199 AGCTGGGCGTGTCGGGGGCGGGG + Intronic
1165026776 19:32968208-32968230 AGCAGGTGGTGGAGGGGGGCAGG - Intronic
1165423449 19:35733255-35733277 AGCACGCCGAGGAGGGGGCCTGG - Exonic
1165677877 19:37743972-37743994 ACCAGGGCCTGTTGGGGGCTGGG + Intronic
1165899717 19:39163380-39163402 ATCAGAGCCTGGAGGGGGCGGGG + Intronic
1166343109 19:42150412-42150434 GGGAGGGGGTGGAGAGGGCTGGG + Intronic
1166671588 19:44713225-44713247 AGCAGGGAGGGCAGTGGGCTGGG - Intergenic
1166800767 19:45455785-45455807 AAGAGGGCGTGGAGGGGGCCAGG + Intronic
1166843178 19:45711390-45711412 AGCATGGCAGGGAGGGGGTTGGG + Exonic
1166984185 19:46649698-46649720 GCCACGGCGTGCAGGGGGCTGGG + Exonic
1167083060 19:47290394-47290416 AGCTGGGCGTGGTGGGGGTCGGG + Intronic
1167168276 19:47813938-47813960 AGAAGGGCGTGGTGGGGGCGGGG + Intronic
1167231985 19:48290674-48290696 AACCGGGGGTGGAGGGGGCCGGG + Intergenic
1167456597 19:49599564-49599586 AGCAGGGGTGGCAGGGGGCTGGG - Exonic
1167461261 19:49625782-49625804 GGGAGGGAGTGGAGGGGGCTTGG - Exonic
1167645273 19:50702430-50702452 AGCAGGGCCTGGGCTGGGCTGGG - Intronic
1167798559 19:51726391-51726413 AGCAGGGCGGGGTGGGGGCTGGG - Intergenic
1168022276 19:53617991-53618013 AGCCGGGCGTGGTGGTGGCGGGG + Intergenic
1202700312 1_KI270712v1_random:159138-159160 GGAAGGGTGTGGATGGGGCTGGG + Intergenic
925833538 2:7919746-7919768 AGCATGGCGTGAAGGAGGGTGGG - Intergenic
925929242 2:8694062-8694084 GGGAGGGGGTGGAGGGGGCTGGG + Intergenic
926045949 2:9709728-9709750 AGCAGGGGTTGGGGGAGGCTGGG - Intergenic
926055841 2:9773473-9773495 TGCAGGAGCTGGAGGGGGCTTGG - Intergenic
926197856 2:10774543-10774565 TGCAGGGAGTGTAGGGGCCTGGG - Intronic
926337776 2:11877131-11877153 AGCAGGTCTGGGAAGGGGCTGGG - Intergenic
927769752 2:25849296-25849318 AGCTGGGGGTGGTGGTGGCTGGG + Intronic
928373613 2:30758489-30758511 GACAGGGCTTGGAGGAGGCTGGG - Intronic
928654823 2:33439741-33439763 AGAAGTGCCTGGAGGAGGCTGGG + Intronic
931694944 2:64864765-64864787 AGAATTGGGTGGAGGGGGCTGGG - Intergenic
932343083 2:70978881-70978903 GGCAGGGCCTGGAGCGGGCGGGG + Intronic
934153343 2:89171309-89171331 AGCAGGGAATGGAGCAGGCTGGG + Intergenic
934171245 2:89542614-89542636 GGAAGGGTGTGGATGGGGCTGGG + Intergenic
934213892 2:90010622-90010644 AGCAGGGAATGGAGCAGGCTGGG - Intergenic
934281551 2:91616932-91616954 GGAAGGGTGTGGATGGGGCTGGG + Intergenic
934763207 2:96867528-96867550 AGCGAGGCGTGGAGAGGGCGAGG + Intronic
934948250 2:98557844-98557866 AGGCGGGGGTGGAGGGGGATGGG - Intronic
935332710 2:101988742-101988764 AGCAGGCTCTGGAGGGGGCCAGG + Intergenic
935620776 2:105127784-105127806 AACAGGGCGAGGGGTGGGCTGGG - Intergenic
936113707 2:109685589-109685611 ACCAGGCCGTGCAGGGGGCAAGG - Intergenic
936547623 2:113406315-113406337 TTCAGGGCAGGGAGGGGGCTGGG - Intergenic
936585785 2:113756574-113756596 AGGAGGGCGTGGAGCGGGTGAGG + Exonic
937306501 2:120874820-120874842 AGCTGGGGGTGGAGGGTACTCGG + Intronic
938072356 2:128315412-128315434 AGCAGGGAATGGGAGGGGCTTGG + Intronic
938110403 2:128560375-128560397 TGCAGGGCATGGGGGGAGCTGGG + Intergenic
938263077 2:129909035-129909057 GGCAGGGGCTGGAGGTGGCTGGG - Intergenic
938279812 2:130055973-130055995 AGGAGGGGGTGGAGGTGGGTTGG - Intergenic
938330764 2:130446687-130446709 AGGAGGGGGTGGAGGTGGGTTGG - Intergenic
938359180 2:130674816-130674838 AGGAGGGGGTGGAGGTGGGTTGG + Intergenic
938435581 2:131281465-131281487 AGTAGGGGGTGGAGGTGGGTTGG + Intronic
939028900 2:137046841-137046863 AGCAGTGAGTGGAGGTGGCTGGG + Intronic
940196555 2:151101500-151101522 ATCAGGAAGTGGTGGGGGCTTGG + Intergenic
941367029 2:164621567-164621589 GGCAAGGCGCGGAGGGGGCGGGG + Exonic
941464046 2:165804166-165804188 AGCTGGGCGTGGAGGCCACTTGG - Intergenic
942276270 2:174326293-174326315 AGCAGGGGGTGGGCGGGTCTGGG - Intergenic
943322631 2:186464463-186464485 AGGAGGGTGGGAAGGGGGCTAGG + Intergenic
944556711 2:200894547-200894569 AGCCGGGCGTGGTGGGGGGCGGG - Intronic
945753899 2:213822732-213822754 ACCAGGGCCTGTTGGGGGCTGGG - Intronic
946157696 2:217817963-217817985 AGGAGGGCGTGGAAGGAGCCTGG + Exonic
947137184 2:226987163-226987185 ACCAGGGCCTGTTGGGGGCTGGG + Intronic
947349962 2:229233392-229233414 GGCAGGGTGGGGATGGGGCTGGG + Intronic
947394636 2:229674610-229674632 AGCAGAGTGTGAAGGTGGCTGGG - Intronic
947507865 2:230723732-230723754 ACCAGGGCATGGAGAGGGCAGGG - Intronic
948047099 2:234952600-234952622 GGGAGGGCGTGGAGGGGTCGGGG + Intronic
948464172 2:238144349-238144371 AGGAGGGCAGGGAGGGTGCTCGG + Intronic
948583940 2:239006805-239006827 AGCAGAGAGTGGAAGGGGCCTGG - Intergenic
948770278 2:240248243-240248265 AGCAGGGGGTGGATGGGCCTGGG - Intergenic
948790100 2:240372522-240372544 GGCAGGGCATGGAGGGGGCAGGG + Intergenic
948831213 2:240599151-240599173 AGCAGGCTGTGGGGAGGGCTGGG + Intronic
948832859 2:240606754-240606776 TGCAGTGCGGGGAGTGGGCTTGG + Intronic
949007205 2:241656433-241656455 GGAAGGGTGTGGTGGGGGCTGGG - Intronic
949036344 2:241817234-241817256 AGCAGGGCAGGGTGGGGGCAGGG + Exonic
949047291 2:241877821-241877843 AGAGGGACGGGGAGGGGGCTGGG - Intergenic
1168795090 20:606048-606070 ACCTGGGGGTGGAGGGGGCAGGG - Intronic
1169209024 20:3755430-3755452 AGCAGGGCCTGGATGGGTGTGGG - Intronic
1169260745 20:4136281-4136303 AGCAGGACCTGGAGGGCGCAGGG + Intronic
1170715166 20:18824891-18824913 ATCAGGGCTTGGAGGAGTCTGGG - Intronic
1171255933 20:23689086-23689108 GGCAGGGCATGGAGGTGGGTGGG - Intergenic
1171272345 20:23826777-23826799 GGCAGGTCATGGAGGGGGGTGGG - Intergenic
1172284694 20:33732265-33732287 AGGCCGGCGGGGAGGGGGCTCGG + Intronic
1172624044 20:36337317-36337339 GGCAGGCTGTGGAGGGGGATGGG + Intronic
1172662050 20:36574470-36574492 GGAAGGGAGGGGAGGGGGCTGGG - Intronic
1172765029 20:37346460-37346482 TGCAGCGGGGGGAGGGGGCTGGG + Intronic
1173570266 20:44071394-44071416 AGCAGGGCGGGGTGGGGGGAGGG - Intergenic
1173869596 20:46332949-46332971 AGAGGGGAGGGGAGGGGGCTGGG + Intergenic
1174044113 20:47721308-47721330 AGCAGAGCGAGCTGGGGGCTGGG + Intronic
1174105912 20:48161974-48161996 ATCAGGGGGTGGATGGGGTTGGG - Intergenic
1174138772 20:48398497-48398519 AGCTGTACCTGGAGGGGGCTGGG + Intergenic
1174213047 20:48895112-48895134 AGCTGGGAGTGGAGGGGGCAGGG + Intergenic
1174283276 20:49454556-49454578 AGGTGGGCGAGGAGGGGGTTGGG + Intronic
1174602027 20:51732424-51732446 AGCAGGTCCTGGTGGGTGCTGGG + Intronic
1174628420 20:51935184-51935206 GGCAGGGCATGGAGGAGGCCTGG + Intergenic
1175242487 20:57560127-57560149 TTTAGGGAGTGGAGGGGGCTTGG - Intergenic
1175680780 20:60987002-60987024 AGCAGGGTGTGGCAGGGTCTTGG - Intergenic
1175720958 20:61287055-61287077 AGCAGGGCACGGAGGGGACCTGG - Intronic
1175897505 20:62345921-62345943 GGCAGGGGGTGTAGGGTGCTAGG - Intronic
1175900035 20:62356367-62356389 AGCGGGGCGTGGAGGGGGAAGGG - Intronic
1175985906 20:62764058-62764080 AGCAGGGCTGGGAGGGGTCTGGG + Intergenic
1176046944 20:63097636-63097658 AGCAGGACGTGGAGGGTGAGCGG - Intergenic
1176056252 20:63150764-63150786 AGCTGGGCGTGGTCTGGGCTGGG - Intergenic
1176129628 20:63491190-63491212 AGCAGGGCCTGCAGGGAGCAGGG - Intronic
1176304914 21:5118286-5118308 AGCCGGGCGTGCAGGAGGCGGGG - Intronic
1176975557 21:15316860-15316882 ACCAGGGCCTGTCGGGGGCTGGG - Intergenic
1178280141 21:31274963-31274985 AGCTGGGTGTGGTGGGGGCGGGG + Intronic
1178466138 21:32849800-32849822 AGCAGGGAGGGGAGGGGGAAAGG + Intergenic
1179480351 21:41673026-41673048 AGCAGGGGGTGGGGGGCGGTGGG - Intergenic
1179502370 21:41818177-41818199 AGCAGGTGGTGAAAGGGGCTGGG + Intronic
1179852140 21:44143744-44143766 AGCCGGGCGTGCAGGAGGCGGGG + Intronic
1179911968 21:44455460-44455482 GGCGGGGCCTGGAGGGGGCGGGG - Intergenic
1180170500 21:46055763-46055785 AGCTGGGCGTGGTGGGAGCTGGG + Intergenic
1180199269 21:46214993-46215015 AGCTGGGCGTGCAGGGGTCCAGG + Intronic
1180590621 22:16934100-16934122 AGCAGGGAGTGGAGCAGGCTGGG + Intergenic
1180675098 22:17581292-17581314 AGCAGGGCATGGAGGCGGCTGGG + Intronic
1180791167 22:18576559-18576581 GGCAGGTAGTGGAGGGGCCTTGG - Intergenic
1180996893 22:19970327-19970349 AGCTAGGCAGGGAGGGGGCTGGG - Exonic
1181116072 22:20633196-20633218 GGCAGGGAGTGGCGGGGGGTTGG - Intergenic
1181165206 22:20979535-20979557 AGCAGGGCCTGGGCGGGGTTAGG + Intronic
1181230571 22:21418755-21418777 GGCAGGTAGTGGAGGGGCCTTGG + Intronic
1181234962 22:21443162-21443184 GGCAGGGAGTGGAGGAGGATTGG + Intronic
1181236309 22:21449730-21449752 AGCTGGGCTTGGAGGGGCCCTGG - Exonic
1181248079 22:21516114-21516136 GGCAGGTAGTGGAGGGGCCTTGG - Intergenic
1181569006 22:23756982-23757004 AGGAGGGAGTTGAGGGGGTTGGG - Intergenic
1181963483 22:26640040-26640062 AGGAGGGGGTGGAGGGGGAAAGG - Intergenic
1183281611 22:36935505-36935527 AGCAGGGCCTGGAGGGAGCTGGG - Intronic
1183320869 22:37164319-37164341 AGCAGAGTGAGGAGGGGGCACGG + Intronic
1184089566 22:42285108-42285130 AGCAGGGCCTGGAGGGGCCCTGG - Intronic
1184114869 22:42416605-42416627 AGGTGGGTGTAGAGGGGGCTGGG + Intronic
1184130229 22:42513115-42513137 AGCAGAGCTGGGAGGGGGATGGG - Intronic
1184140405 22:42574938-42574960 AGCAGAGCTGGGAGGGGGATGGG - Intergenic
1184342855 22:43895649-43895671 AGGAGGCAGGGGAGGGGGCTTGG - Intergenic
1184347683 22:43923668-43923690 GGCGGGGCTTGGAGGGGGATGGG - Intergenic
1184561834 22:45268317-45268339 AGGAGGGAGGGGAGAGGGCTGGG - Intergenic
1184744099 22:46446125-46446147 AGTATGGTGTGGAGGGGGCTGGG - Intronic
1184751053 22:46487014-46487036 GGCAGGAAGTGGAGGGGGCAGGG - Intronic
1184760530 22:46541352-46541374 CTCAGGGCGGGGAGGGGGCTTGG + Intergenic
1184775231 22:46619805-46619827 AGGAGGGCCAGGTGGGGGCTGGG + Intronic
1184840649 22:47050706-47050728 TGCAGGCCATGGCGGGGGCTCGG + Intronic
1184993438 22:48185596-48185618 AGCAGGGCGTGGGTGGGGCTGGG - Intergenic
1185076837 22:48687715-48687737 AGCAGGGTGTGTATGGAGCTGGG - Intronic
1185243094 22:49756834-49756856 AGCAGGGGCTGGAGAGGGCGGGG - Intergenic
1185277953 22:49957861-49957883 AGGTGGGCGTGGCGGGGTCTTGG - Intergenic
949617143 3:5766268-5766290 ACCAGGGCGTGTTGGGGGTTGGG + Intergenic
949768189 3:7550265-7550287 AGGAGGGGGAGGAGGGGGTTGGG - Intronic
950619124 3:14188957-14188979 ACCAGGGCCTGTCGGGGGCTGGG - Intronic
950863906 3:16173988-16174010 AGCAGAGCAGGGATGGGGCTGGG - Intergenic
951705009 3:25535565-25535587 ACCAGGGCCTGTCGGGGGCTGGG - Intronic
952329104 3:32347488-32347510 GGCAGGGCTTGGAGGGGGCAGGG + Intronic
952889474 3:38030608-38030630 AGCTCTGCGGGGAGGGGGCTGGG + Intergenic
953025438 3:39142298-39142320 GGCAGGAAGTGGAGGGGGCAGGG + Exonic
954297486 3:49682283-49682305 AAAAGAGCGTCGAGGGGGCTGGG + Intronic
954326909 3:49868927-49868949 AGCTATGCGGGGAGGGGGCTGGG + Intronic
954372248 3:50175047-50175069 AGCTGGGGGTGGCAGGGGCTGGG - Intronic
954436103 3:50497179-50497201 AGCAGGGCGTGGAGAGGAGCAGG + Intronic
954440218 3:50517600-50517622 AGCCAGGCCTGGAGGGGACTTGG - Intergenic
954676750 3:52320130-52320152 AGCAGGGCTTGGAGAGGCCAGGG - Intronic
954829191 3:53404196-53404218 ACCAGGGCCTGTCGGGGGCTAGG - Intergenic
955687689 3:61562583-61562605 GGCTGGCCGGGGAGGGGGCTGGG + Intronic
956542524 3:70357572-70357594 ACCAGGGCCTGCTGGGGGCTGGG + Intergenic
956587510 3:70879868-70879890 AGCAAGGGGTGGAGGGAGATGGG + Intergenic
957934362 3:86923344-86923366 AGCAGGGCCTGGGGGGAGATGGG - Intergenic
959679491 3:109076813-109076835 ACCAGGGCCTGGCGGGGGATCGG + Intronic
960047383 3:113211462-113211484 AGGAGGGAGTGGAGGAGGCTGGG - Exonic
960333605 3:116391578-116391600 AGCAGGGCGCGGGGGTGGCAAGG + Intronic
961038605 3:123661217-123661239 AGCTGGGCATCGTGGGGGCTGGG + Intronic
961043439 3:123693349-123693371 AGAAGTGGGTGGAGGAGGCTAGG + Intronic
961067022 3:123884285-123884307 AGCAGGGCGCTGAGCGAGCTCGG - Intronic
961306522 3:125961488-125961510 AGCAGGGAGTGAGGGGGCCTGGG - Intergenic
961326923 3:126114529-126114551 GGCCGGGCCTGGAGGGGGCAGGG - Intronic
961459695 3:127042632-127042654 GGCAGCCAGTGGAGGGGGCTGGG - Intergenic
961807692 3:129501071-129501093 AACAGGGAGAGGAGGGGGTTGGG + Intronic
962349363 3:134645226-134645248 AGGAGGGTGAGGAGGCGGCTGGG + Intronic
962514049 3:136132008-136132030 GTCAGGGGGTGGGGGGGGCTGGG + Intronic
963744183 3:149109624-149109646 AGCAGGGGGTGAAGGGGGGAAGG - Intergenic
964705248 3:159611515-159611537 ACCAGGGCGTGTTGGGGGGTGGG + Intronic
964859638 3:161186902-161186924 ACCAGGGCCTGTTGGGGGCTGGG + Intronic
966230158 3:177642674-177642696 GGGAGGTTGTGGAGGGGGCTGGG - Intergenic
966401801 3:179555213-179555235 AGCAGGAGGTGGAGGGAGGTGGG - Intergenic
966732548 3:183162838-183162860 AGCAGGGAGGGGCGGGGACTCGG + Exonic
966860541 3:184229219-184229241 GGCAGGGGGTGGGGTGGGCTGGG + Intronic
966943232 3:184759983-184760005 GGCAGGGCAGGGAGGGGGCATGG + Intergenic
967217879 3:187225586-187225608 AGCAAGGGCTGGATGGGGCTGGG - Intronic
967429170 3:189361701-189361723 GGCAGGGTGGGGGGGGGGCTGGG - Intergenic
968066074 3:195760481-195760503 AGGATGGAGTGGAGGGGGCTGGG + Intronic
968066098 3:195760556-195760578 AGGATGGAGTGGAGGGGGCTGGG + Intronic
968066107 3:195760594-195760616 AGTATGGAGTGAAGGGGGCTGGG + Intronic
968088313 3:195884717-195884739 ACCAGGGTGTGGATGGGACTGGG - Intronic
968131687 3:196196048-196196070 ACCAGGGTGTGGAGGAGGGTGGG - Intergenic
968446130 4:653245-653267 GGCAGGGCCTGGTGGGGCCTGGG + Intronic
968531531 4:1094400-1094422 AGCTGGGGGTGGGGGAGGCTTGG + Intronic
968909798 4:3471919-3471941 AGCAAGGCGTGGTGTGGGCGCGG - Intronic
968966759 4:3772701-3772723 AGCAGGCAGTGGAGGAGGATGGG + Intergenic
969048570 4:4356470-4356492 TGCTGGGGGTGGAGAGGGCTTGG - Intronic
969691910 4:8708592-8708614 TGCAGGGCGTGGTGGGGCATGGG - Intergenic
970441149 4:16082540-16082562 AGCTAGGCCTGGAGGGGGCTTGG - Intronic
970520403 4:16878108-16878130 AGCAGGTAGGGGAAGGGGCTTGG + Intronic
970745020 4:19283928-19283950 ACCGGGGCCTGTAGGGGGCTTGG + Intergenic
970857602 4:20666977-20666999 AGCTGGGAGAGGAGTGGGCTGGG + Intergenic
971458022 4:26861669-26861691 AGCAGGGTCTGCAGGGGACTGGG + Intronic
972618462 4:40723060-40723082 TGCAGGAGGTGGAGGGGGCTGGG - Intergenic
973535098 4:51873126-51873148 AGGAGAGCGTGAAGGGTGCTGGG - Intronic
974804246 4:66859381-66859403 ACCAGGGCTTGTAGGGGGTTGGG + Intergenic
976009602 4:80471564-80471586 AGCAGGGCGGGGGTGGGGGTGGG + Intronic
976602421 4:86950113-86950135 AGCAGGGCAGGGATGGGACTTGG + Intronic
978917785 4:114147502-114147524 AGCAGGGAGGGGAGGGCGGTGGG + Intergenic
979978070 4:127221458-127221480 ACCAGGGCCTGTTGGGGGCTGGG - Intergenic
980836461 4:138199590-138199612 GGCAGGGAGTGGAGGAGGCAGGG + Intronic
981859298 4:149335732-149335754 ACCAGGGCCTGTCGGGGGCTTGG - Intergenic
983747823 4:171223637-171223659 ACCAGGGCCTGTAGGGGGGTGGG + Intergenic
984420212 4:179511750-179511772 AACAGAGCGTGGTGGGGGATGGG + Intergenic
984578020 4:181474151-181474173 ACCAGGGCCTGTAGGGGGATGGG + Intergenic
985005061 4:185526121-185526143 AGCAGGGCATGGAGGAAGATGGG + Intronic
985411449 4:189689934-189689956 AGAAGGGGCTGCAGGGGGCTGGG - Intergenic
985483187 5:131265-131287 ACCAGGGCCTGTTGGGGGCTGGG - Intergenic
985523720 5:391377-391399 CGCAGGGCGAGGAGGGCGCAGGG + Intronic
985523765 5:391524-391546 GGCAGGGCGAGGAGGGCGCAGGG + Intronic
985523780 5:391573-391595 GGCAGGGCGAGGAGGGCGCAGGG + Intronic
985523807 5:391671-391693 GGCAGGGCGAGGAGGGCGCAGGG + Intronic
985523822 5:391720-391742 GGCAGGGCGAGGAGGGCGCAGGG + Intronic
985523837 5:391769-391791 GGCAGGGCGAGGAGGGCGCAGGG + Intronic
985523862 5:391867-391889 CGCAGGGCGAGGAGGGCGCAGGG + Intronic
985523886 5:391973-391995 CGCAGGGCGAGGAGGGCGCAGGG + Intronic
985523899 5:392022-392044 CGCAGGGCGAGGAGGGCGCAGGG + Intronic
985523923 5:392128-392150 CGCAGGGCGAGGAGGGCGCAGGG + Intronic
985523936 5:392177-392199 CGCAGGGCGAGGAGGGCGCAGGG + Intronic
985523961 5:392275-392297 CGCAGGGCGAGGAGGGCGCAGGG + Intronic
985523974 5:392324-392346 CGCAGGGCGAGGAGGGCGCAGGG + Intronic
985523987 5:392373-392395 CGCAGGGCGAGGAGGGCGCAGGG + Intronic
985669943 5:1201978-1202000 CGCAGGGTGTGGGGGGAGCTGGG + Intronic
985688663 5:1295100-1295122 GGGAGGGCCCGGAGGGGGCTGGG + Intergenic
985708374 5:1414452-1414474 GGCAGGGCGGGGAAGGCGCTGGG + Intronic
985753802 5:1701070-1701092 AGCAGGCCTTGGAGAGGGCAGGG - Intergenic
986137915 5:4999811-4999833 ACCAGGGCCTGTTGGGGGCTGGG - Intergenic
986982635 5:13466911-13466933 ACCAGGGCCTGTTGGGGGCTGGG - Intergenic
987072861 5:14354160-14354182 AGCAGGGCTGGGAGGGTGGTTGG + Intronic
988719732 5:33864825-33864847 ATCAGGGCCTGTAGGGGGTTAGG + Intronic
988780458 5:34516584-34516606 GGCAGGGCGTGGTGGGGGCTTGG - Intergenic
988820260 5:34876824-34876846 ATCAGGGCCTGTCGGGGGCTGGG + Intronic
990089819 5:52029265-52029287 AGCAGGGCTTGTCGGGGGGTGGG - Intronic
991718212 5:69471865-69471887 ACCAGGGCCTGTAGGGGGGTGGG + Intergenic
992546377 5:77817801-77817823 AGAAGGGCCTGGAGAAGGCTTGG - Intronic
994368858 5:98946946-98946968 GGCAGAGCTTGCAGGGGGCTGGG - Intergenic
996345435 5:122483603-122483625 AGCCGGGCGTGGTGGCGGGTGGG - Intergenic
996443859 5:123521920-123521942 AGTAGGGCCTGGAAAGGGCTAGG + Intronic
996622464 5:125524705-125524727 AAGTGGGCGTGGAGTGGGCTAGG - Intergenic
997438044 5:133889268-133889290 AGCAGGGCCTGTAGGAGGCAGGG + Intergenic
997643669 5:135466307-135466329 TCCAGGGCGTGGAGGGGGCCGGG - Intergenic
998935167 5:147226851-147226873 AGCCAGGCGTGGAGGAGGGTGGG - Intergenic
999076857 5:148804516-148804538 AGCAGGGGGAGGAGGGGTCGAGG + Intergenic
1000305095 5:159987469-159987491 AAAGGGGCGTGGAGCGGGCTCGG - Intergenic
1001056918 5:168457436-168457458 AGCTGGCTGTGGAGGGGGCAGGG - Intronic
1001381477 5:171309317-171309339 GGCTGGGCGGGGAGGCGGCTGGG - Exonic
1001423031 5:171601254-171601276 AGGAGGGGGTGGGAGGGGCTGGG + Intergenic
1001586107 5:172834666-172834688 GGCAGGCTGGGGAGGGGGCTCGG - Intronic
1001642182 5:173252306-173252328 AGGAGTTCGTGGAGGGGGCCTGG + Intergenic
1001941343 5:175741859-175741881 AGAAGGGGGTGGAGGAGGCCAGG + Intergenic
1002074964 5:176703029-176703051 AGCAGGGGGTGGGGTGGGATGGG - Intergenic
1002535369 5:179872858-179872880 AGCAGGGCTGGGCAGGGGCTGGG - Intronic
1002541160 5:179907517-179907539 AGCCGGGCGCGGAGGGGCCGGGG - Intronic
1002563466 5:180097644-180097666 AGCAGGGCCTGCAGAGGGCCGGG + Intergenic
1002944610 6:1749441-1749463 AGCTGGGCGTGGTGGGGGCGGGG + Intronic
1003631438 6:7791130-7791152 ACCAGAGGGTGGAGGGGGCATGG + Intronic
1004036704 6:11931463-11931485 AGAAGGACTTGGTGGGGGCTCGG + Intergenic
1004511681 6:16288534-16288556 AGGAGCCCGTGGAGGGGGCGGGG - Intronic
1004903153 6:20212265-20212287 AGCAGGGGGTGTTGCGGGCTGGG - Exonic
1005120200 6:22380817-22380839 ACCAGGGAGTGGGGTGGGCTTGG + Intergenic
1005620000 6:27611295-27611317 AGCATGGCCTGGAGTGGGGTGGG + Intergenic
1005920732 6:30398186-30398208 AGCAGGGCCTGGAGGTGCTTGGG - Intergenic
1006301623 6:33196458-33196480 ACCAGGGCGTTGAGGGTCCTGGG - Exonic
1006860623 6:37169870-37169892 AGCTGGGCGGGGCGGGGGCGGGG + Intergenic
1006981951 6:38154270-38154292 AGCAGGCAGAGGAGGGGGCGGGG - Exonic
1007293368 6:40803271-40803293 GGCAGTGGGGGGAGGGGGCTGGG + Intergenic
1007386500 6:41523674-41523696 TGCAGGGGATGGAGGAGGCTTGG - Intergenic
1007747500 6:44051904-44051926 AGCCGGGCAAGGAGGGAGCTGGG - Intergenic
1008772277 6:54992844-54992866 AGCAGGGAGTGGAGAGGGTGGGG - Intergenic
1008810554 6:55492800-55492822 AGAAGGGAGGGAAGGGGGCTAGG - Intronic
1012701412 6:102461459-102461481 ACCAGGGCCTGTTGGGGGCTGGG + Intergenic
1012988108 6:105896753-105896775 ATCAGAGCGTGGAAGGTGCTGGG - Intergenic
1013973315 6:116046617-116046639 ACCAGGGCCTGCAGGGGGGTAGG + Intronic
1014947604 6:127516101-127516123 AGAAGGGGGAGGAGGGGGCGGGG - Exonic
1016005465 6:139084578-139084600 ATCAGGGTGTGTTGGGGGCTAGG - Intergenic
1016781651 6:147965773-147965795 ACCAGGGCCTGTAGGGGGCTGGG + Intergenic
1016782002 6:147969105-147969127 ACCAGGGCCTGTTGGGGGCTGGG - Intergenic
1017001035 6:149997717-149997739 TGCCGAGCGTGGAGTGGGCTGGG + Intergenic
1017637870 6:156460584-156460606 AGGGCGGCGTGGAGGGGGGTGGG - Intergenic
1017722036 6:157250160-157250182 AGCACAGCATGGAGGGGCCTGGG + Intergenic
1017780511 6:157711797-157711819 AGCAGGACTTGGAGGGGGACTGG + Intronic
1017914043 6:158818608-158818630 GGCCGGGCGGGGAGGGGTCTGGG + Intronic
1018055574 6:160049463-160049485 AGCAGGGGATGGAGAGGGCGAGG + Intronic
1018056043 6:160053256-160053278 ACCAGGGCCTGTTGGGGGCTGGG + Intronic
1018293533 6:162318076-162318098 ACCAGGGCCTGGAGAGGGGTAGG - Intronic
1018494714 6:164337603-164337625 AGCAGGGCGCGGTGGCGGCCCGG - Intergenic
1018941037 6:168308909-168308931 GCCACGGCGTGCAGGGGGCTGGG + Exonic
1019125881 6:169839917-169839939 GGCATGGCGTGGAGTGGGCATGG - Intergenic
1019335529 7:480876-480898 TTCAGGGCCTGGAGGGGACTGGG - Intergenic
1019365416 7:630200-630222 TGAAAGGTGTGGAGGGGGCTGGG + Intronic
1019379629 7:714067-714089 AGGAGGGAGTGGAGGGGCCGCGG - Intronic
1019447634 7:1079679-1079701 GGCAGGCCCTGGCGGGGGCTGGG + Intronic
1019536086 7:1530629-1530651 CGCGGGGCGGGGAGGGGGCGTGG + Intergenic
1019732108 7:2634157-2634179 AGCCGGGAGTGGAGGCGGCGGGG - Intronic
1020032171 7:4940744-4940766 AGCAAGGGGTGGAAGGGGCCCGG + Intronic
1020096780 7:5374060-5374082 AACAGGGCCTGGAAGGGGCTGGG + Exonic
1020143367 7:5624442-5624464 AGAAGGGTTTGGAGAGGGCTGGG + Intronic
1020438340 7:8189759-8189781 AGGAGTGTGGGGAGGGGGCTGGG + Intronic
1021970509 7:25961126-25961148 AGAAGGCAGGGGAGGGGGCTGGG - Intergenic
1023937198 7:44748626-44748648 AGAAAGGTGTGGAGGGGGCTGGG + Intronic
1023944902 7:44795843-44795865 AGCTGGGCGGGGCGGGGGCAGGG + Intergenic
1024112658 7:46162699-46162721 AGCTGGGTGTGGGTGGGGCTTGG + Intergenic
1025206376 7:56995688-56995710 GCCAGGCCGGGGAGGGGGCTGGG + Intergenic
1026004842 7:66592345-66592367 AGCGGGGCGAGGAGGAGGGTGGG - Intergenic
1026765090 7:73155154-73155176 GGCAGGGCGCGGAGGGGGCGGGG + Intergenic
1026876198 7:73880406-73880428 AGCACGGGGTGGAAGGGGCCAGG - Intergenic
1026911101 7:74092531-74092553 GGCAGGGCCTGCAAGGGGCTGGG - Intronic
1026935828 7:74254697-74254719 AGCAGGGCCTGGAGGGGTTGCGG + Intergenic
1027041563 7:74964909-74964931 GGCAGGGCGCGGAGGGGGCGGGG + Exonic
1027051627 7:75024868-75024890 AGGAGGGCATGGAGAGGCCTTGG - Intergenic
1027082079 7:75237460-75237482 GGCAGGGCGCGGAGGGGGCGGGG - Intergenic
1027973780 7:85122073-85122095 ACCAGGGCCTGTTGGGGGCTGGG + Intronic
1028288445 7:89034405-89034427 ACCAGGGCCTGGCGGGGGGTAGG - Intronic
1028984050 7:96996200-96996222 AGCTGAGCGTGGCGGGGGCGGGG + Intergenic
1029021376 7:97368181-97368203 ACCAGGGCCTGTTGGGGGCTGGG + Intergenic
1029150127 7:98474373-98474395 AGCAGAGCGTGGTGGGGGTGGGG + Intergenic
1029390659 7:100272006-100272028 GGCAGGGCGCGGAGGGGGCGGGG - Exonic
1029460513 7:100691593-100691615 AGCAGGAGGTGGCGGGGGCTGGG + Intergenic
1029465796 7:100723793-100723815 AACGAGGGGTGGAGGGGGCTGGG + Intergenic
1029506633 7:100967022-100967044 ACCAGGGCAGGGAGGGGGCTGGG + Intronic
1029729805 7:102432027-102432049 AGTAGGGAGTGGAAGGGGCCAGG + Intergenic
1030058931 7:105607760-105607782 AGGAGGGAGGGGAGTGGGCTGGG - Exonic
1030347961 7:108455289-108455311 CGCGCGGCGTGGAGGGGGCCGGG + Intronic
1032696972 7:134345545-134345567 AGCAAGGCTTAGCGGGGGCTTGG + Intergenic
1033479529 7:141725643-141725665 AGCAGGCAGCGGAGGGGGCGTGG + Intronic
1033984207 7:147202783-147202805 ACCAGGGCCTGTAGGGGGGTAGG + Intronic
1034404808 7:150896352-150896374 AGGATGGAGGGGAGGGGGCTTGG - Intergenic
1034543511 7:151775259-151775281 ATCAGGGCGGGGTGGGGGGTAGG - Intronic
1034544126 7:151778548-151778570 AGCAGGGCTTGGAGAAGGCATGG - Intronic
1034698094 7:153072936-153072958 AGGAGGGAGTGGAGGGTGCTGGG + Intergenic
1035553132 8:544983-545005 AGGAGGGCTTGGAGCGGGCCTGG - Intronic
1035731269 8:1854990-1855012 GGGAGGGAGTGGAGGGGCCTCGG + Intronic
1037531923 8:19784688-19784710 AGCAGGGCCTGTTGGGGGCTGGG + Intergenic
1037764498 8:21763898-21763920 AGCATGGAGTGGGGGTGGCTGGG - Intronic
1037802725 8:22044114-22044136 AGCCTGGCTGGGAGGGGGCTGGG + Intronic
1037992481 8:23330792-23330814 AGCAGGGTGTGGTGGGGGTTTGG + Intronic
1038483016 8:27914701-27914723 GCCAGGGCATGGAGGTGGCTGGG + Intronic
1039052205 8:33505256-33505278 AGCAGGGTGGGGAGGGGGAAAGG + Intronic
1039435670 8:37557636-37557658 AGAAGGGCGGGGAGGCAGCTAGG - Intergenic
1039648110 8:39309103-39309125 ACCAGGGCCTGTTGGGGGCTGGG + Intergenic
1039955306 8:42202740-42202762 AGCAGGGTGGGGACGGGGGTGGG + Intronic
1040071920 8:43195607-43195629 AGGAGGGTGTGGAGGAGGATGGG + Intronic
1040072694 8:43201346-43201368 AGCAGGGAGTGGAGTGGGAGGGG - Exonic
1041406380 8:57504085-57504107 AGCAGGGCCTGTGGGGAGCTGGG - Intergenic
1041433306 8:57808900-57808922 AGCAGGGAGTGAAGGGGGAGAGG - Intergenic
1041604233 8:59761551-59761573 AGCAGGAAGTGGGTGGGGCTAGG - Intergenic
1041932039 8:63297387-63297409 AACAGGGGGTGGTGGGGACTGGG + Intergenic
1042354843 8:67815679-67815701 TGCAGGGAGTGGAGCGGGGTGGG + Intergenic
1043414449 8:80033298-80033320 GGCGGGGCGGGGAGGGGGGTTGG + Intronic
1043502764 8:80873728-80873750 AGCAGGCGGCGGAGGGGGCTCGG - Intronic
1044555389 8:93557087-93557109 TGCAGGATGTAGAGGGGGCTGGG + Intergenic
1045211361 8:100103488-100103510 AGCATAGTGTGGAGGGGCCTGGG + Intronic
1045499091 8:102731459-102731481 AGCAGGGAGTGGAGAGGGTTAGG - Intergenic
1046433376 8:114156338-114156360 ACCAGGGCCTGTTGGGGGCTGGG + Intergenic
1046538527 8:115548485-115548507 AGCAGGGCGTGGTGGCGGGCGGG - Intronic
1047248734 8:123166101-123166123 ATCAGGGCCGGGAGGGGGCTGGG + Intergenic
1047435842 8:124834918-124834940 ACCAAGGCCTGGAGGGGGCTGGG - Intergenic
1047928449 8:129703179-129703201 AGGAGGGCGTGGGGTGGGCTAGG - Intergenic
1048267493 8:133000318-133000340 GGCAAGGGGTGGAGGGAGCTAGG - Intronic
1048326473 8:133443041-133443063 AGCTGGGCCTGGTGGGGGGTGGG - Intergenic
1048989719 8:139754193-139754215 AGCAGGGTCTGGAGAGGGCCAGG - Intronic
1049237446 8:141519167-141519189 AGCAGGATGGGGAGGGGGCCGGG + Intergenic
1049347839 8:142148156-142148178 AGCAGGGCATGGAGGGGCGGAGG + Intergenic
1049400921 8:142426865-142426887 ATCTGGGAGAGGAGGGGGCTTGG - Intergenic
1049428676 8:142549337-142549359 TGCAGGGCCTGGAGAGGCCTCGG + Intergenic
1049428706 8:142549413-142549435 TGCAGGGCCTGGAGAGGCCTGGG + Intergenic
1049531592 8:143158164-143158186 AGCCTGGCGTGGCTGGGGCTGGG - Exonic
1049576895 8:143393707-143393729 AGCAGTGCCTGGTGGGGGTTGGG + Intergenic
1049686744 8:143942168-143942190 AGAAGGGGCTGGAGGGGGCGGGG - Intronic
1049692005 8:143965601-143965623 AGAAGGGACTGGAGGAGGCTGGG - Intronic
1049696789 8:143987976-143987998 ATCAGGGTGTGCAGGGGGCATGG - Intronic
1049788658 8:144463017-144463039 AGGTGGGCGGGGAGGGGGCGCGG + Intronic
1050250072 9:3734498-3734520 AGCAGGATGTGGGGGGGGGTGGG + Intergenic
1050611414 9:7357757-7357779 AGCAGGGGGTGGAGCGGGGTTGG + Intergenic
1052116896 9:24659906-24659928 TGCAAGGGGTGGAGGGGGCGGGG - Intergenic
1053163564 9:35829501-35829523 AGCGGGGCGAGGGCGGGGCTGGG - Exonic
1053233809 9:36434304-36434326 AGCAGGAGGGGGAGGGGGATGGG + Intronic
1055023438 9:71694269-71694291 AGCTGGGCGTAGAGGCGGGTGGG - Intronic
1055460207 9:76512279-76512301 GGCTGGGCGTGGGGGGGGATGGG - Intergenic
1055580851 9:77705056-77705078 ATCAGGGCCTGTTGGGGGCTAGG - Intergenic
1055795968 9:79975252-79975274 GGCAGGGAGTGGCGGGGGCAGGG + Intergenic
1055905934 9:81293055-81293077 AGCGGGGCGGGGAGGGTGGTTGG + Intergenic
1056208750 9:84344792-84344814 AGCAAGGGGAGGAGGGGGTTGGG - Intergenic
1056254398 9:84783822-84783844 GGCAGGGCATGAAGGGGGCTAGG + Intronic
1056558212 9:87707134-87707156 AGCAGGGCGTGGAGGGGGCTGGG - Exonic
1056615282 9:88160238-88160260 AGCAGGGGCTGGAGGGAGCTGGG - Intergenic
1056793483 9:89640794-89640816 AGCCGGGGCTGGAGAGGGCTGGG - Intergenic
1056965329 9:91160094-91160116 AGAGGGGCGGGGAGGGTGCTTGG - Intergenic
1057045771 9:91885324-91885346 GGCAGGGTGTGGAGGGAGATGGG + Intronic
1057135059 9:92681719-92681741 GGCAGGTGGTGGAGGGGGCAAGG + Intergenic
1057230359 9:93317919-93317941 AGCAGGCGGTGGGGGGGACTCGG - Exonic
1057758062 9:97853053-97853075 GTCAGGGCGGGGAGGGCGCTTGG - Intergenic
1058053369 9:100427453-100427475 GGCCGGGCGTAGAGGGGGCCGGG + Intronic
1058111096 9:101030953-101030975 AGCAGGGGGTGGGGGGGAATTGG + Intronic
1058346647 9:103971538-103971560 AGCAGGGCCTGGTGGGGGATGGG - Intergenic
1059783648 9:117556470-117556492 AGAAGGGAGTGGGGGCGGCTGGG + Intergenic
1059923864 9:119186797-119186819 GGCAGGGCGTGGCTGTGGCTTGG - Intronic
1060034319 9:120242138-120242160 GGCAGGGCATGCAGAGGGCTAGG + Intergenic
1060297737 9:122354788-122354810 AGCAGGGCCAGCAGGAGGCTGGG + Intergenic
1060301595 9:122377473-122377495 AGCAGGCCGGGGCGGGGGGTGGG - Intronic
1060367523 9:123033582-123033604 AACAGGGAGAAGAGGGGGCTTGG - Intronic
1060508880 9:124218010-124218032 AGCGGGCCTTGGAGAGGGCTGGG - Intergenic
1060551150 9:124486011-124486033 GGCAGGGGCGGGAGGGGGCTGGG + Intronic
1060604324 9:124900280-124900302 AGCAGGGGGTGGAGGGAGTCAGG - Intronic
1060727008 9:126012878-126012900 AGTAGAGGGTGGAGGTGGCTGGG + Intergenic
1060860883 9:126954012-126954034 GGCAGTGTGTGGAGGGCGCTGGG - Intronic
1061178712 9:129011913-129011935 AGCAGGAGGTGGAGGGGCCCTGG + Intronic
1061661086 9:132130767-132130789 AGCAGGGGAAGGATGGGGCTGGG - Intergenic
1061836722 9:133334340-133334362 TGCAGGGCGGGGCTGGGGCTGGG - Intronic
1061864402 9:133485005-133485027 GGCAGGATCTGGAGGGGGCTGGG + Intergenic
1062070815 9:134554093-134554115 AGCAGGGGGGTGTGGGGGCTGGG + Intergenic
1062180496 9:135188808-135188830 GGCATGGCATGGTGGGGGCTTGG - Intergenic
1062282116 9:135756820-135756842 AGCAGGCCGGGGCTGGGGCTGGG - Intronic
1062314765 9:135961220-135961242 AGGCGGGCGGGGAGGGGGCGGGG + Exonic
1062363537 9:136198476-136198498 CCCAGGGCGGGGAGGGTGCTGGG + Intronic
1062365508 9:136206659-136206681 AGCAGAGCGTCGGTGGGGCTGGG - Exonic
1062459343 9:136656414-136656436 ATCAGGGCGTGGAGGGTCTTGGG - Intergenic
1062537646 9:137027922-137027944 GGCCCGGCGGGGAGGGGGCTCGG + Intronic
1062629044 9:137455455-137455477 AGCAGGGCCTGCTGGGAGCTGGG - Intronic
1062698041 9:137885325-137885347 ATCTGTGTGTGGAGGGGGCTGGG + Intronic
1203671146 Un_KI270755v1:13048-13070 AGAAGGGGCTGCAGGGGGCTGGG + Intergenic
1185491526 X:520984-521006 ACCAGGGCCTGTCGGGGGCTGGG + Intergenic
1185779011 X:2829455-2829477 TGCAGAGCGTGGAGGGGGCTCGG + Intronic
1185907063 X:3944855-3944877 AGGAAGGCGTGGAGGGAGCAAGG - Intergenic
1187875494 X:23800345-23800367 ACCAGGGCGTGGTGGGGGGGGGG + Intergenic
1188241675 X:27800538-27800560 AGCGGGGCGTGGTGGCGGGTGGG - Intergenic
1189333362 X:40156023-40156045 AGCAGGGCGCGGAGGACGCGCGG - Intronic
1189925228 X:45946385-45946407 ACCAGGGCCTGTTGGGGGCTGGG - Intergenic
1190318145 X:49164198-49164220 GGCAGGGCCTGGAGAGTGCTTGG + Intronic
1190319627 X:49172420-49172442 GGCAGGGCGTGGCGCGGCCTGGG + Intronic
1190568006 X:51750805-51750827 AGCTGAGCTTGGAGGTGGCTAGG + Intergenic
1192525259 X:71837408-71837430 ACCAGGGCCTGTTGGGGGCTGGG + Intergenic
1193299076 X:79867795-79867817 GGCGGGGGGTGGAGGGGGCTGGG - Intergenic
1193351359 X:80468539-80468561 AGCAGGGCCTGTTGGGGGGTGGG + Intergenic
1193597666 X:83466732-83466754 AGCAGGGCCTGTTGGGGGGTGGG - Intergenic
1195825774 X:108998905-108998927 ACCAGGGCCTGTTGGGGGCTGGG - Intergenic
1195827601 X:109019483-109019505 AGCAGGGCCTGTCGGGGGCTAGG - Intergenic
1195897586 X:109762754-109762776 ACCAGGGCCTGTTGGGGGCTGGG + Intergenic
1198219110 X:134583724-134583746 ACCAGGGGGTGGAGGGAGGTGGG - Intronic
1198741132 X:139844318-139844340 AGCAGAGAGTGGAGGGCTCTGGG + Intronic
1200072311 X:153535313-153535335 AGAAGAGCGTGGAGGGGAGTGGG + Intronic
1200090303 X:153632867-153632889 AGCAGGGCTAGGCCGGGGCTGGG + Intergenic
1200117748 X:153776662-153776684 GGCAGGGCGAGGATGGGGCGGGG + Intronic
1201291027 Y:12421044-12421066 TGCAGGGCGTGGAGGGGATTCGG - Intergenic
1201986447 Y:19973717-19973739 ACCAGGGCCTGCTGGGGGCTGGG + Intergenic