ID: 1056558700

View in Genome Browser
Species Human (GRCh38)
Location 9:87711021-87711043
Sequence AAGAATAAAAAGATGGAGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056558696_1056558700 15 Left 1056558696 9:87710983-87711005 CCTGGGCAACAAGCGCAAAAATT No data
Right 1056558700 9:87711021-87711043 AAGAATAAAAAGATGGAGGCGGG No data
1056558694_1056558700 29 Left 1056558694 9:87710969-87710991 CCACTGCACTCCAGCCTGGGCAA 0: 66497
1: 175004
2: 225621
3: 191618
4: 110379
Right 1056558700 9:87711021-87711043 AAGAATAAAAAGATGGAGGCGGG No data
1056558695_1056558700 19 Left 1056558695 9:87710979-87711001 CCAGCCTGGGCAACAAGCGCAAA 0: 28
1: 10547
2: 20835
3: 32086
4: 57602
Right 1056558700 9:87711021-87711043 AAGAATAAAAAGATGGAGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056558700 Original CRISPR AAGAATAAAAAGATGGAGGC GGG Intergenic
No off target data available for this crispr