ID: 1056565722

View in Genome Browser
Species Human (GRCh38)
Location 9:87771073-87771095
Sequence GTGGACTAAACAGGAACCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056565711_1056565722 9 Left 1056565711 9:87771041-87771063 CCCTGCATTCTTCCACCCGGCCC No data
Right 1056565722 9:87771073-87771095 GTGGACTAAACAGGAACCACTGG No data
1056565713_1056565722 -3 Left 1056565713 9:87771053-87771075 CCACCCGGCCCCACCTTTCTGTG No data
Right 1056565722 9:87771073-87771095 GTGGACTAAACAGGAACCACTGG No data
1056565716_1056565722 -7 Left 1056565716 9:87771057-87771079 CCGGCCCCACCTTTCTGTGGACT No data
Right 1056565722 9:87771073-87771095 GTGGACTAAACAGGAACCACTGG No data
1056565715_1056565722 -6 Left 1056565715 9:87771056-87771078 CCCGGCCCCACCTTTCTGTGGAC No data
Right 1056565722 9:87771073-87771095 GTGGACTAAACAGGAACCACTGG No data
1056565712_1056565722 8 Left 1056565712 9:87771042-87771064 CCTGCATTCTTCCACCCGGCCCC No data
Right 1056565722 9:87771073-87771095 GTGGACTAAACAGGAACCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056565722 Original CRISPR GTGGACTAAACAGGAACCAC TGG Intergenic
No off target data available for this crispr