ID: 1056567278

View in Genome Browser
Species Human (GRCh38)
Location 9:87785284-87785306
Sequence TTGACTTTACACAGACATCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056567275_1056567278 7 Left 1056567275 9:87785254-87785276 CCTTGATGTGCACATAGGCCAGG No data
Right 1056567278 9:87785284-87785306 TTGACTTTACACAGACATCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056567278 Original CRISPR TTGACTTTACACAGACATCT CGG Intergenic
No off target data available for this crispr