ID: 1056568240

View in Genome Browser
Species Human (GRCh38)
Location 9:87793708-87793730
Sequence ATGGCTCCTGCATTTGGGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056568231_1056568240 16 Left 1056568231 9:87793669-87793691 CCTGTCTCCTATAACGTGGGGCA No data
Right 1056568240 9:87793708-87793730 ATGGCTCCTGCATTTGGGTGAGG No data
1056568232_1056568240 9 Left 1056568232 9:87793676-87793698 CCTATAACGTGGGGCAGTGATGG No data
Right 1056568240 9:87793708-87793730 ATGGCTCCTGCATTTGGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056568240 Original CRISPR ATGGCTCCTGCATTTGGGTG AGG Intergenic
No off target data available for this crispr