ID: 1056568360

View in Genome Browser
Species Human (GRCh38)
Location 9:87794699-87794721
Sequence CAACATGAATTGTTTCTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056568358_1056568360 -10 Left 1056568358 9:87794686-87794708 CCTTAAAAAGTCTCAACATGAAT No data
Right 1056568360 9:87794699-87794721 CAACATGAATTGTTTCTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056568360 Original CRISPR CAACATGAATTGTTTCTGCA GGG Intergenic
No off target data available for this crispr