ID: 1056568999

View in Genome Browser
Species Human (GRCh38)
Location 9:87799511-87799533
Sequence GCTCAGCAGCTCCACAGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056568999_1056569003 -1 Left 1056568999 9:87799511-87799533 CCTGCACTGTGGAGCTGCTGAGC No data
Right 1056569003 9:87799533-87799555 CAATGCACCTGGGGTACCCCTGG No data
1056568999_1056569006 11 Left 1056568999 9:87799511-87799533 CCTGCACTGTGGAGCTGCTGAGC No data
Right 1056569006 9:87799545-87799567 GGTACCCCTGGATGACCAGAGGG No data
1056568999_1056569010 20 Left 1056568999 9:87799511-87799533 CCTGCACTGTGGAGCTGCTGAGC No data
Right 1056569010 9:87799554-87799576 GGATGACCAGAGGGTTCAGCTGG No data
1056568999_1056569002 -10 Left 1056568999 9:87799511-87799533 CCTGCACTGTGGAGCTGCTGAGC No data
Right 1056569002 9:87799524-87799546 GCTGCTGAGCAATGCACCTGGGG No data
1056568999_1056569005 10 Left 1056568999 9:87799511-87799533 CCTGCACTGTGGAGCTGCTGAGC No data
Right 1056569005 9:87799544-87799566 GGGTACCCCTGGATGACCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056568999 Original CRISPR GCTCAGCAGCTCCACAGTGC AGG (reversed) Intergenic