ID: 1056569003

View in Genome Browser
Species Human (GRCh38)
Location 9:87799533-87799555
Sequence CAATGCACCTGGGGTACCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056568996_1056569003 24 Left 1056568996 9:87799486-87799508 CCTGGACTACTAGGGGCTCACCT No data
Right 1056569003 9:87799533-87799555 CAATGCACCTGGGGTACCCCTGG No data
1056568998_1056569003 4 Left 1056568998 9:87799506-87799528 CCTCGCCTGCACTGTGGAGCTGC No data
Right 1056569003 9:87799533-87799555 CAATGCACCTGGGGTACCCCTGG No data
1056568999_1056569003 -1 Left 1056568999 9:87799511-87799533 CCTGCACTGTGGAGCTGCTGAGC No data
Right 1056569003 9:87799533-87799555 CAATGCACCTGGGGTACCCCTGG No data
1056568995_1056569003 28 Left 1056568995 9:87799482-87799504 CCTGCCTGGACTACTAGGGGCTC No data
Right 1056569003 9:87799533-87799555 CAATGCACCTGGGGTACCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056569003 Original CRISPR CAATGCACCTGGGGTACCCC TGG Intergenic
No off target data available for this crispr