ID: 1056569006

View in Genome Browser
Species Human (GRCh38)
Location 9:87799545-87799567
Sequence GGTACCCCTGGATGACCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056568998_1056569006 16 Left 1056568998 9:87799506-87799528 CCTCGCCTGCACTGTGGAGCTGC No data
Right 1056569006 9:87799545-87799567 GGTACCCCTGGATGACCAGAGGG No data
1056568999_1056569006 11 Left 1056568999 9:87799511-87799533 CCTGCACTGTGGAGCTGCTGAGC No data
Right 1056569006 9:87799545-87799567 GGTACCCCTGGATGACCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056569006 Original CRISPR GGTACCCCTGGATGACCAGA GGG Intergenic
No off target data available for this crispr