ID: 1056570580

View in Genome Browser
Species Human (GRCh38)
Location 9:87811102-87811124
Sequence CTGAGAGAGCCCTTAGTGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056570577_1056570580 -8 Left 1056570577 9:87811087-87811109 CCTGTGTGCAAGGTCCTGAGAGA No data
Right 1056570580 9:87811102-87811124 CTGAGAGAGCCCTTAGTGATGGG No data
1056570572_1056570580 14 Left 1056570572 9:87811065-87811087 CCCTGGGTCCTTTGTACAGCCGC No data
Right 1056570580 9:87811102-87811124 CTGAGAGAGCCCTTAGTGATGGG No data
1056570576_1056570580 -5 Left 1056570576 9:87811084-87811106 CCGCCTGTGTGCAAGGTCCTGAG No data
Right 1056570580 9:87811102-87811124 CTGAGAGAGCCCTTAGTGATGGG No data
1056570573_1056570580 13 Left 1056570573 9:87811066-87811088 CCTGGGTCCTTTGTACAGCCGCC No data
Right 1056570580 9:87811102-87811124 CTGAGAGAGCCCTTAGTGATGGG No data
1056570574_1056570580 6 Left 1056570574 9:87811073-87811095 CCTTTGTACAGCCGCCTGTGTGC No data
Right 1056570580 9:87811102-87811124 CTGAGAGAGCCCTTAGTGATGGG No data
1056570571_1056570580 28 Left 1056570571 9:87811051-87811073 CCATGGAGGGAAGTCCCTGGGTC No data
Right 1056570580 9:87811102-87811124 CTGAGAGAGCCCTTAGTGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056570580 Original CRISPR CTGAGAGAGCCCTTAGTGAT GGG Intergenic