ID: 1056572087

View in Genome Browser
Species Human (GRCh38)
Location 9:87825114-87825136
Sequence CTGTAGAAGCTGACTGGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056572087_1056572093 16 Left 1056572087 9:87825114-87825136 CCTTCTCCAGTCAGCTTCTACAG No data
Right 1056572093 9:87825153-87825175 TGTCCTCTCCCGCCAGACACGGG 0: 1
1: 0
2: 1
3: 8
4: 149
1056572087_1056572097 27 Left 1056572087 9:87825114-87825136 CCTTCTCCAGTCAGCTTCTACAG No data
Right 1056572097 9:87825164-87825186 GCCAGACACGGGCGCCCCCCTGG 0: 1
1: 0
2: 0
3: 16
4: 98
1056572087_1056572101 30 Left 1056572087 9:87825114-87825136 CCTTCTCCAGTCAGCTTCTACAG No data
Right 1056572101 9:87825167-87825189 AGACACGGGCGCCCCCCTGGGGG 0: 1
1: 0
2: 0
3: 6
4: 86
1056572087_1056572099 28 Left 1056572087 9:87825114-87825136 CCTTCTCCAGTCAGCTTCTACAG No data
Right 1056572099 9:87825165-87825187 CCAGACACGGGCGCCCCCCTGGG 0: 1
1: 0
2: 0
3: 4
4: 100
1056572087_1056572092 15 Left 1056572087 9:87825114-87825136 CCTTCTCCAGTCAGCTTCTACAG No data
Right 1056572092 9:87825152-87825174 GTGTCCTCTCCCGCCAGACACGG 0: 1
1: 0
2: 0
3: 9
4: 127
1056572087_1056572100 29 Left 1056572087 9:87825114-87825136 CCTTCTCCAGTCAGCTTCTACAG No data
Right 1056572100 9:87825166-87825188 CAGACACGGGCGCCCCCCTGGGG 0: 1
1: 0
2: 2
3: 22
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056572087 Original CRISPR CTGTAGAAGCTGACTGGAGA AGG (reversed) Intergenic
No off target data available for this crispr