ID: 1056574109

View in Genome Browser
Species Human (GRCh38)
Location 9:87842275-87842297
Sequence GACCCTAGGAGGGTGGGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056574109_1056574118 9 Left 1056574109 9:87842275-87842297 CCAGTCCCCACCCTCCTAGGGTC No data
Right 1056574118 9:87842307-87842329 CCATCTCATCATGTGTTTTGAGG No data
1056574109_1056574119 10 Left 1056574109 9:87842275-87842297 CCAGTCCCCACCCTCCTAGGGTC No data
Right 1056574119 9:87842308-87842330 CATCTCATCATGTGTTTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056574109 Original CRISPR GACCCTAGGAGGGTGGGGAC TGG (reversed) Intergenic
No off target data available for this crispr