ID: 1056574178

View in Genome Browser
Species Human (GRCh38)
Location 9:87842706-87842728
Sequence TGGAAGAACTCACAGCCCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056574178_1056574188 19 Left 1056574178 9:87842706-87842728 CCTGCGGGCTGTGAGTTCTTCCA No data
Right 1056574188 9:87842748-87842770 TGGACTAAACAGGAACCACTGGG No data
1056574178_1056574187 18 Left 1056574178 9:87842706-87842728 CCTGCGGGCTGTGAGTTCTTCCA No data
Right 1056574187 9:87842747-87842769 GTGGACTAAACAGGAACCACTGG No data
1056574178_1056574181 -1 Left 1056574178 9:87842706-87842728 CCTGCGGGCTGTGAGTTCTTCCA No data
Right 1056574181 9:87842728-87842750 AACCGGCCCCTTCTTTGCTGTGG No data
1056574178_1056574186 9 Left 1056574178 9:87842706-87842728 CCTGCGGGCTGTGAGTTCTTCCA No data
Right 1056574186 9:87842738-87842760 TTCTTTGCTGTGGACTAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056574178 Original CRISPR TGGAAGAACTCACAGCCCGC AGG (reversed) Intergenic
No off target data available for this crispr