ID: 1056574181

View in Genome Browser
Species Human (GRCh38)
Location 9:87842728-87842750
Sequence AACCGGCCCCTTCTTTGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056574174_1056574181 25 Left 1056574174 9:87842680-87842702 CCCTTAATTGGGAGATAAGGCTT No data
Right 1056574181 9:87842728-87842750 AACCGGCCCCTTCTTTGCTGTGG No data
1056574175_1056574181 24 Left 1056574175 9:87842681-87842703 CCTTAATTGGGAGATAAGGCTTC No data
Right 1056574181 9:87842728-87842750 AACCGGCCCCTTCTTTGCTGTGG No data
1056574178_1056574181 -1 Left 1056574178 9:87842706-87842728 CCTGCGGGCTGTGAGTTCTTCCA No data
Right 1056574181 9:87842728-87842750 AACCGGCCCCTTCTTTGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056574181 Original CRISPR AACCGGCCCCTTCTTTGCTG TGG Intergenic
No off target data available for this crispr