ID: 1056574182

View in Genome Browser
Species Human (GRCh38)
Location 9:87842730-87842752
Sequence GTCCACAGCAAAGAAGGGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056574182_1056574191 16 Left 1056574182 9:87842730-87842752 CCGGCCCCTTCTTTGCTGTGGAC No data
Right 1056574191 9:87842769-87842791 GGCTAGAGTCCTCTGGCTCTCGG No data
1056574182_1056574193 25 Left 1056574182 9:87842730-87842752 CCGGCCCCTTCTTTGCTGTGGAC No data
Right 1056574193 9:87842778-87842800 CCTCTGGCTCTCGGCCCTGCAGG No data
1056574182_1056574189 9 Left 1056574182 9:87842730-87842752 CCGGCCCCTTCTTTGCTGTGGAC No data
Right 1056574189 9:87842762-87842784 ACCACTGGGCTAGAGTCCTCTGG No data
1056574182_1056574187 -6 Left 1056574182 9:87842730-87842752 CCGGCCCCTTCTTTGCTGTGGAC No data
Right 1056574187 9:87842747-87842769 GTGGACTAAACAGGAACCACTGG No data
1056574182_1056574188 -5 Left 1056574182 9:87842730-87842752 CCGGCCCCTTCTTTGCTGTGGAC No data
Right 1056574188 9:87842748-87842770 TGGACTAAACAGGAACCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056574182 Original CRISPR GTCCACAGCAAAGAAGGGGC CGG (reversed) Intergenic
No off target data available for this crispr