ID: 1056574186

View in Genome Browser
Species Human (GRCh38)
Location 9:87842738-87842760
Sequence TTCTTTGCTGTGGACTAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056574178_1056574186 9 Left 1056574178 9:87842706-87842728 CCTGCGGGCTGTGAGTTCTTCCA No data
Right 1056574186 9:87842738-87842760 TTCTTTGCTGTGGACTAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056574186 Original CRISPR TTCTTTGCTGTGGACTAAAC AGG Intergenic
No off target data available for this crispr