ID: 1056574187

View in Genome Browser
Species Human (GRCh38)
Location 9:87842747-87842769
Sequence GTGGACTAAACAGGAACCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056574180_1056574187 -2 Left 1056574180 9:87842726-87842748 CCAACCGGCCCCTTCTTTGCTGT No data
Right 1056574187 9:87842747-87842769 GTGGACTAAACAGGAACCACTGG No data
1056574178_1056574187 18 Left 1056574178 9:87842706-87842728 CCTGCGGGCTGTGAGTTCTTCCA No data
Right 1056574187 9:87842747-87842769 GTGGACTAAACAGGAACCACTGG No data
1056574183_1056574187 -10 Left 1056574183 9:87842734-87842756 CCCCTTCTTTGCTGTGGACTAAA No data
Right 1056574187 9:87842747-87842769 GTGGACTAAACAGGAACCACTGG No data
1056574182_1056574187 -6 Left 1056574182 9:87842730-87842752 CCGGCCCCTTCTTTGCTGTGGAC No data
Right 1056574187 9:87842747-87842769 GTGGACTAAACAGGAACCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056574187 Original CRISPR GTGGACTAAACAGGAACCAC TGG Intergenic
No off target data available for this crispr