ID: 1056574193

View in Genome Browser
Species Human (GRCh38)
Location 9:87842778-87842800
Sequence CCTCTGGCTCTCGGCCCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056574184_1056574193 20 Left 1056574184 9:87842735-87842757 CCCTTCTTTGCTGTGGACTAAAC No data
Right 1056574193 9:87842778-87842800 CCTCTGGCTCTCGGCCCTGCAGG No data
1056574183_1056574193 21 Left 1056574183 9:87842734-87842756 CCCCTTCTTTGCTGTGGACTAAA No data
Right 1056574193 9:87842778-87842800 CCTCTGGCTCTCGGCCCTGCAGG No data
1056574182_1056574193 25 Left 1056574182 9:87842730-87842752 CCGGCCCCTTCTTTGCTGTGGAC No data
Right 1056574193 9:87842778-87842800 CCTCTGGCTCTCGGCCCTGCAGG No data
1056574185_1056574193 19 Left 1056574185 9:87842736-87842758 CCTTCTTTGCTGTGGACTAAACA No data
Right 1056574193 9:87842778-87842800 CCTCTGGCTCTCGGCCCTGCAGG No data
1056574190_1056574193 -8 Left 1056574190 9:87842763-87842785 CCACTGGGCTAGAGTCCTCTGGC No data
Right 1056574193 9:87842778-87842800 CCTCTGGCTCTCGGCCCTGCAGG No data
1056574180_1056574193 29 Left 1056574180 9:87842726-87842748 CCAACCGGCCCCTTCTTTGCTGT No data
Right 1056574193 9:87842778-87842800 CCTCTGGCTCTCGGCCCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056574193 Original CRISPR CCTCTGGCTCTCGGCCCTGC AGG Intergenic
No off target data available for this crispr