ID: 1056575521

View in Genome Browser
Species Human (GRCh38)
Location 9:87853393-87853415
Sequence CATGTCCCCTTTTCAGTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056575521_1056575527 27 Left 1056575521 9:87853393-87853415 CCTGGAACTGAAAAGGGGACATG No data
Right 1056575527 9:87853443-87853465 AAGTGTCCCCAAGAGGAGCATGG No data
1056575521_1056575525 -9 Left 1056575521 9:87853393-87853415 CCTGGAACTGAAAAGGGGACATG No data
Right 1056575525 9:87853407-87853429 GGGGACATGGAGCATTCACGGGG No data
1056575521_1056575524 -10 Left 1056575521 9:87853393-87853415 CCTGGAACTGAAAAGGGGACATG No data
Right 1056575524 9:87853406-87853428 AGGGGACATGGAGCATTCACGGG No data
1056575521_1056575526 20 Left 1056575521 9:87853393-87853415 CCTGGAACTGAAAAGGGGACATG No data
Right 1056575526 9:87853436-87853458 GCTGTGCAAGTGTCCCCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056575521 Original CRISPR CATGTCCCCTTTTCAGTTCC AGG (reversed) Intergenic
No off target data available for this crispr