ID: 1056575527

View in Genome Browser
Species Human (GRCh38)
Location 9:87853443-87853465
Sequence AAGTGTCCCCAAGAGGAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056575521_1056575527 27 Left 1056575521 9:87853393-87853415 CCTGGAACTGAAAAGGGGACATG No data
Right 1056575527 9:87853443-87853465 AAGTGTCCCCAAGAGGAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056575527 Original CRISPR AAGTGTCCCCAAGAGGAGCA TGG Intergenic
No off target data available for this crispr