ID: 1056575657

View in Genome Browser
Species Human (GRCh38)
Location 9:87854356-87854378
Sequence ATCAGACTTCAGGCCAAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056575657_1056575661 10 Left 1056575657 9:87854356-87854378 CCAGCTTTGGCCTGAAGTCTGAT No data
Right 1056575661 9:87854389-87854411 AAATGTTAATGGAGGAGATGAGG No data
1056575657_1056575660 2 Left 1056575657 9:87854356-87854378 CCAGCTTTGGCCTGAAGTCTGAT No data
Right 1056575660 9:87854381-87854403 TGTAAATAAAATGTTAATGGAGG No data
1056575657_1056575659 -1 Left 1056575657 9:87854356-87854378 CCAGCTTTGGCCTGAAGTCTGAT No data
Right 1056575659 9:87854378-87854400 TTTTGTAAATAAAATGTTAATGG No data
1056575657_1056575662 20 Left 1056575657 9:87854356-87854378 CCAGCTTTGGCCTGAAGTCTGAT No data
Right 1056575662 9:87854399-87854421 GGAGGAGATGAGGTGCCTACAGG No data
1056575657_1056575663 21 Left 1056575657 9:87854356-87854378 CCAGCTTTGGCCTGAAGTCTGAT No data
Right 1056575663 9:87854400-87854422 GAGGAGATGAGGTGCCTACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056575657 Original CRISPR ATCAGACTTCAGGCCAAAGC TGG (reversed) Intergenic
No off target data available for this crispr