ID: 1056576425

View in Genome Browser
Species Human (GRCh38)
Location 9:87858730-87858752
Sequence GGCTGCTTCCCCATTGCTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056576423_1056576425 -4 Left 1056576423 9:87858711-87858733 CCAGGGGCCTAGAGGTGGAGGCT 0: 7
1: 3
2: 10
3: 72
4: 972
Right 1056576425 9:87858730-87858752 GGCTGCTTCCCCATTGCTACAGG No data
1056576419_1056576425 5 Left 1056576419 9:87858702-87858724 CCTGAGTCTCCAGGGGCCTAGAG 0: 10
1: 1
2: 3
3: 22
4: 203
Right 1056576425 9:87858730-87858752 GGCTGCTTCCCCATTGCTACAGG No data
1056576418_1056576425 6 Left 1056576418 9:87858701-87858723 CCCTGAGTCTCCAGGGGCCTAGA 0: 10
1: 1
2: 7
3: 21
4: 179
Right 1056576425 9:87858730-87858752 GGCTGCTTCCCCATTGCTACAGG No data
1056576414_1056576425 25 Left 1056576414 9:87858682-87858704 CCGGGGGGAAGTGGGGTTTCCCT No data
Right 1056576425 9:87858730-87858752 GGCTGCTTCCCCATTGCTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056576425 Original CRISPR GGCTGCTTCCCCATTGCTAC AGG Intergenic
No off target data available for this crispr