ID: 1056577761

View in Genome Browser
Species Human (GRCh38)
Location 9:87869089-87869111
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056577756_1056577761 25 Left 1056577756 9:87869041-87869063 CCCATGTTGGGGCAGGTCAAGAA No data
Right 1056577761 9:87869089-87869111 CTGTAGGAGAAGAGAGAAGATGG No data
1056577758_1056577761 -5 Left 1056577758 9:87869071-87869093 CCTTACAGACCAGTGCATCTGTA No data
Right 1056577761 9:87869089-87869111 CTGTAGGAGAAGAGAGAAGATGG No data
1056577757_1056577761 24 Left 1056577757 9:87869042-87869064 CCATGTTGGGGCAGGTCAAGAAG No data
Right 1056577761 9:87869089-87869111 CTGTAGGAGAAGAGAGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056577761 Original CRISPR CTGTAGGAGAAGAGAGAAGA TGG Intergenic
No off target data available for this crispr