ID: 1056578847

View in Genome Browser
Species Human (GRCh38)
Location 9:87876014-87876036
Sequence CTCCCGTCCAGGTCCTGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056578847_1056578856 24 Left 1056578847 9:87876014-87876036 CCCAGGCAGGACCTGGACGGGAG No data
Right 1056578856 9:87876061-87876083 AACACAGGGAACGATGAGGGAGG No data
1056578847_1056578852 9 Left 1056578847 9:87876014-87876036 CCCAGGCAGGACCTGGACGGGAG No data
Right 1056578852 9:87876046-87876068 TGGAGCATTTGCAGCAACACAGG No data
1056578847_1056578853 10 Left 1056578847 9:87876014-87876036 CCCAGGCAGGACCTGGACGGGAG No data
Right 1056578853 9:87876047-87876069 GGAGCATTTGCAGCAACACAGGG No data
1056578847_1056578857 25 Left 1056578847 9:87876014-87876036 CCCAGGCAGGACCTGGACGGGAG No data
Right 1056578857 9:87876062-87876084 ACACAGGGAACGATGAGGGAGGG No data
1056578847_1056578858 26 Left 1056578847 9:87876014-87876036 CCCAGGCAGGACCTGGACGGGAG No data
Right 1056578858 9:87876063-87876085 CACAGGGAACGATGAGGGAGGGG No data
1056578847_1056578854 20 Left 1056578847 9:87876014-87876036 CCCAGGCAGGACCTGGACGGGAG No data
Right 1056578854 9:87876057-87876079 CAGCAACACAGGGAACGATGAGG No data
1056578847_1056578855 21 Left 1056578847 9:87876014-87876036 CCCAGGCAGGACCTGGACGGGAG No data
Right 1056578855 9:87876058-87876080 AGCAACACAGGGAACGATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056578847 Original CRISPR CTCCCGTCCAGGTCCTGCCT GGG (reversed) Intergenic