ID: 1056580814

View in Genome Browser
Species Human (GRCh38)
Location 9:87887153-87887175
Sequence TCCCAGGAAAATGGGAACCT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 1, 2: 2, 3: 29, 4: 295}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056580814_1056580818 -6 Left 1056580814 9:87887153-87887175 CCAAGGTTCCCATTTTCCTGGGA 0: 1
1: 1
2: 2
3: 29
4: 295
Right 1056580818 9:87887170-87887192 CTGGGAAAACGTCCTCAGAATGG 0: 1
1: 0
2: 0
3: 8
4: 128
1056580814_1056580819 0 Left 1056580814 9:87887153-87887175 CCAAGGTTCCCATTTTCCTGGGA 0: 1
1: 1
2: 2
3: 29
4: 295
Right 1056580819 9:87887176-87887198 AAACGTCCTCAGAATGGTCCAGG 0: 1
1: 0
2: 2
3: 3
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056580814 Original CRISPR TCCCAGGAAAATGGGAACCT TGG (reversed) Exonic
900261276 1:1731037-1731059 TCCCAGCACTATGGGAAGCTGGG + Intronic
900340280 1:2185289-2185311 TCCGTGGAAAATGTGCACCTTGG - Exonic
900345190 1:2207178-2207200 TGCCAGCAGACTGGGAACCTGGG - Intronic
901864157 1:12093103-12093125 TCTCATGAAAAGGGGAAACTTGG - Intronic
902663471 1:17921517-17921539 TCCCAGGGAAATGAGAGACTTGG - Intergenic
902869221 1:19303471-19303493 TCCAAGGGAAATGAGGACCTTGG + Intergenic
903392226 1:22972649-22972671 TCCTAGGCAAATGGGACCATTGG + Intergenic
903511559 1:23879487-23879509 TCCCAGGTAAATGGGAATACAGG - Intronic
905440141 1:37990420-37990442 TCTCAGGAAAATGGGAATAGTGG + Exonic
907932545 1:59014097-59014119 TCCTAGGCACATGGGAGCCTCGG + Intergenic
907933020 1:59017639-59017661 TCACAGGACAATGGGAAACTAGG + Intergenic
909373059 1:74909154-74909176 GTCCAGGACACTGGGAACCTGGG - Intergenic
911691188 1:100836543-100836565 CCCAAGGAAAATGGGAATTTTGG + Intergenic
915449338 1:155993931-155993953 TCCCAGGAGAAAGGGAGCCTGGG - Intronic
915791326 1:158674789-158674811 AATCAGGAAAAAGGGAACCTAGG - Intronic
915955478 1:160217060-160217082 TCCCAGGAAAATAGGATTCTGGG + Exonic
917371110 1:174295327-174295349 TCCCAGCAACTTGGGAAGCTAGG - Intronic
919938499 1:202270797-202270819 TCCCAGGGAGATGGGGACATAGG - Intronic
921148988 1:212385189-212385211 TCCTAGGAAAAAGGAAACTTGGG + Intronic
922505554 1:226123494-226123516 TTCAAGAAAACTGGGAACCTAGG - Intergenic
923273209 1:232375767-232375789 TCCCTGGAAGATGGGAACGAGGG - Intergenic
924456985 1:244226790-244226812 GCACAGGAAAATGGGAAAATTGG + Intergenic
1064057081 10:12106755-12106777 TCCCTGGAAAATGGGATTCAGGG - Intronic
1068372450 10:56135079-56135101 TCCCAGGATATAGGGAGCCTTGG - Intergenic
1068587520 10:58816039-58816061 GCCCAGGAAAATGGAAACATTGG - Intronic
1068812010 10:61266582-61266604 TCCCAGGAAACTGGGAATGGGGG + Intergenic
1069820606 10:71225368-71225390 TGCCAGGGAAATGGGCACGTGGG - Intronic
1069890321 10:71648526-71648548 TCCAAGGACCATGGGAACTTGGG - Intronic
1070285876 10:75083342-75083364 TCCCAGAAAAATGGGAAAGGGGG - Intergenic
1071986683 10:91058630-91058652 TCCTAGGAAAATGGGAACCTTGG + Intergenic
1072893027 10:99341746-99341768 TTCCAGCAAAATGGGGAGCTAGG + Intronic
1073466396 10:103696842-103696864 TCCCAGGAAAACAGGGACATGGG + Intronic
1074232652 10:111553275-111553297 TTCCAGAAAGATGGGGACCTGGG + Intergenic
1075442008 10:122487402-122487424 TGCCACGAAAATGGGAGCCCAGG + Intronic
1075898579 10:126019715-126019737 CCCCAGGACAATGGGAGACTGGG - Exonic
1076619872 10:131780212-131780234 TCCCAGGCAAATGGGACAGTGGG + Intergenic
1076846880 10:133073621-133073643 AACCCAGAAAATGGGAACCTAGG - Intronic
1079647258 11:22881044-22881066 TCCCAAGAAAACTGGAACTTTGG + Intergenic
1080099726 11:28445900-28445922 TCCCAGGACTTTGGGAGCCTAGG - Intergenic
1080454242 11:32403821-32403843 TCCCAGCACAATGGGAGCCGAGG - Intronic
1082029457 11:47594097-47594119 TTCCAGTAAAGGGGGAACCTCGG + Intronic
1082958922 11:58900776-58900798 TCCTAAGAGAATGGGAAGCTTGG + Intronic
1082974440 11:59058457-59058479 TCCTAAGAGAATGGGAAGCTTGG + Intergenic
1082978849 11:59102250-59102272 TCCTAAGAGAATGGGAAGCTTGG + Intergenic
1083000941 11:59290031-59290053 CCCCAGGCAAATGGGAAACCGGG - Intergenic
1083037916 11:59657483-59657505 GCCCAGGATATTGGGAATCTGGG - Intronic
1083097172 11:60263540-60263562 TCCCTGGAAAAGAGGAAGCTGGG + Intergenic
1083194863 11:61079857-61079879 TCCCAGGTGTATGGGGACCTGGG - Intergenic
1084854092 11:71969684-71969706 TCCCAGGTAAATGGGACCACAGG + Intronic
1084921520 11:72474586-72474608 TCTCAGGAAGATGGGAATCTTGG + Intergenic
1085265831 11:75237384-75237406 TCCCAGGAGAGAGGGATCCTAGG + Intergenic
1086076501 11:82858860-82858882 TCCCAGAGAAATGAGATCCTAGG - Intronic
1086690105 11:89780185-89780207 CCTCAGGAAAATGGTTACCTCGG + Intergenic
1086715749 11:90059772-90059794 CCTCAGGAAAATGGTTACCTCGG - Intergenic
1089151203 11:116365722-116365744 GCCCATCAAAATGGGAATCTTGG - Intergenic
1089185527 11:116612211-116612233 GACCAGGCAAATGGGACCCTGGG + Intergenic
1089307178 11:117533940-117533962 TCCCATGGAAATGGCAGCCTGGG - Intronic
1089560838 11:119342377-119342399 CCCAAGGGAAATGGGAATCTGGG - Intronic
1090127070 11:124097767-124097789 TCCCAGCTACATGGGAAGCTGGG + Intergenic
1090226012 11:125072750-125072772 TCACAGGAGACTGGGAACTTCGG - Intronic
1090664631 11:128906257-128906279 TCCAGGCAAAATAGGAACCTAGG + Intronic
1092012973 12:5131114-5131136 TCCTAAGAAAATGGTAAGCTTGG - Intergenic
1098306520 12:69108155-69108177 TCACAGGAAAAAGGGAGGCTGGG - Intergenic
1098375657 12:69810827-69810849 TCACATGAAAATGGGAAACAAGG + Intronic
1098503321 12:71220016-71220038 TCCCAGGAAACTGAGCACTTAGG - Intronic
1098504508 12:71233566-71233588 TCACAGGAAAACAGAAACCTAGG - Intronic
1100036963 12:90263489-90263511 TCCTAGGAATATGTGAGCCTGGG - Intergenic
1101613573 12:106314481-106314503 TCCCAGAAAAGAGGTAACCTGGG + Exonic
1101839992 12:108321163-108321185 TCTCAGGAGAATGGGAATCAGGG - Intronic
1102575081 12:113851032-113851054 TCACAGGACAGTGGGAGCCTTGG - Intronic
1102686224 12:114726903-114726925 TCCCAGGTACTTGGGAAGCTGGG - Intergenic
1103211772 12:119172419-119172441 TCCCAGTGAAATGGCAACCTTGG - Intergenic
1103569511 12:121835456-121835478 TCCCTTGAACCTGGGAACCTGGG - Intergenic
1104747160 12:131218041-131218063 CCCAAGGAAAAAGTGAACCTCGG - Intergenic
1104824607 12:131700074-131700096 GCCCAGGAAAATGGGAAAACCGG + Intergenic
1105845030 13:24286671-24286693 TCACAGGAAAGTAGGAACCTGGG + Intronic
1106390141 13:29327350-29327372 TCCCAGGAAACTTGGAAGGTTGG - Intronic
1106511961 13:30420508-30420530 TCCCAGAAGAATGGGAATTTGGG + Intergenic
1108676607 13:52742528-52742550 TCTGAGGAAAATGTGAAGCTTGG + Intergenic
1108878981 13:55086122-55086144 TCCCAGAAAATTGGGAGGCTAGG + Intergenic
1111735076 13:92127980-92128002 GCCCAGGCAAATGGAAACCCTGG - Intronic
1112352615 13:98649204-98649226 TCCCAGGAAGCTGGGAATATAGG + Intergenic
1112560117 13:100505611-100505633 TCCCAGCACTCTGGGAACCTGGG + Intronic
1113492533 13:110703751-110703773 TCCCAGGACACTGGGAAACGGGG - Intronic
1114668867 14:24398586-24398608 TCCCAAGAGAACGGGGACCTCGG - Intergenic
1119135972 14:72220452-72220474 TGTCAAGTAAATGGGAACCTGGG + Intronic
1119391339 14:74293119-74293141 GCCCAGGGAAGTGGGAACCATGG - Intronic
1119401335 14:74364699-74364721 TCACAGGAGGATGGGAAGCTAGG + Intergenic
1120017131 14:79486764-79486786 TCTCAGGAAAATGGGGACTGAGG + Intronic
1121084740 14:91137222-91137244 TCCTAGCAATTTGGGAACCTGGG - Intronic
1121570675 14:94944528-94944550 TCCGAGCTAAATCGGAACCTGGG - Intergenic
1122210819 14:100172948-100172970 TGCCATGTAAATGGGAAACTTGG + Intergenic
1123476467 15:20595088-20595110 TCCCGACAAAATGGCAACCTTGG + Intergenic
1123641544 15:22405276-22405298 TCCCGACAAAATGGCAACCTTGG - Intergenic
1123996604 15:25722317-25722339 TCCCTGGGAAATGGGAGCCCAGG - Intronic
1124031252 15:26014142-26014164 TCCAGTGAAAATTGGAACCTAGG - Intergenic
1124638210 15:31378404-31378426 TCCCAGGACACTGGGAGTCTGGG + Intronic
1126831348 15:52609658-52609680 TCACAAGAAAATGAGAACGTGGG - Exonic
1127122225 15:55781554-55781576 AGGCAGGAGAATGGGAACCTGGG - Intergenic
1128663789 15:69523658-69523680 TCCCAGGCATAGGGGAGCCTTGG + Intergenic
1129975405 15:79817179-79817201 TCTCAGGAAAATGGGCTTCTGGG + Intergenic
1130035020 15:80351432-80351454 TCCCAGGAACATGGCAAGATGGG + Intronic
1131296235 15:91151674-91151696 TTCCAAGGAAATGGGAGCCTGGG - Intronic
1132296290 15:100737140-100737162 TCCCCGGGAGCTGGGAACCTGGG + Intergenic
1132781701 16:1630066-1630088 CCTCAGGGAAATGAGAACCTGGG - Intronic
1134088469 16:11375097-11375119 TCCCAGCACTATGGGAAGCTGGG - Intronic
1135863348 16:26077647-26077669 TCCCAGGCTAATGGTATCCTGGG + Intronic
1136540342 16:30924746-30924768 TCCCCGGAAAGGGGGAATCTGGG + Exonic
1136641317 16:31568152-31568174 TTCCAGCAAACTGAGAACCTGGG - Intergenic
1136864709 16:33737656-33737678 TCACGGGAAAATGGGAGTCTTGG + Intergenic
1137493955 16:48954919-48954941 TCCATGGAAGAAGGGAACCTTGG + Intergenic
1138476557 16:57273609-57273631 TCCATGGTAATTGGGAACCTGGG - Intronic
1139904556 16:70354883-70354905 TCCCAGCTAAGTGGGAGCCTGGG + Intronic
1139961781 16:70722115-70722137 TCCCAGGAGAGTGGGGGCCTTGG - Intronic
1141168677 16:81677496-81677518 TCCCAGGCAACTGGGCACGTTGG + Intronic
1203126204 16_KI270728v1_random:1585792-1585814 TCACGGGAAAATGGGAGTCTTGG + Intergenic
1142550895 17:738694-738716 TCCCAGGAAGCTGGGAACACAGG + Intronic
1143377469 17:6475283-6475305 TCCCGGGACAGTGGGCACCTGGG - Intronic
1144165230 17:12604207-12604229 TCCCAGGAGAATGGGAGACCAGG + Intergenic
1144844372 17:18208580-18208602 TACCAAGAATATGAGAACCTAGG - Exonic
1145245276 17:21265153-21265175 TCTCAGGAAAATGAGACCCGAGG + Intergenic
1145405208 17:22584235-22584257 TCCCAAGGAAATTGGAAACTGGG - Intergenic
1146923236 17:36727657-36727679 TCCCAGGAAGACAGGAACCAGGG + Intergenic
1147129425 17:38398108-38398130 TCACAGCAAAAAGGGATCCTGGG - Intronic
1147422622 17:40330288-40330310 TAATAGGAAAATGGGAACCAAGG - Intronic
1149226678 17:54479392-54479414 ACCCAGGAAAATCAGAAACTAGG - Intergenic
1149394162 17:56221897-56221919 TCCCAGGAAACAGGGAACACAGG + Intronic
1150228832 17:63538847-63538869 TCTCAGGAAAATGGGACCTCCGG - Intronic
1150351258 17:64446628-64446650 TCCCAGCTACTTGGGAACCTGGG + Intergenic
1152629227 17:81402510-81402532 ATCCAGGAAAATGGGAAGCAAGG - Intronic
1154434883 18:14335610-14335632 TCCCTGGAAAAGCGGGACCTGGG - Intergenic
1155725504 18:29076845-29076867 TCCCAGGAAAACGGAAAGCTGGG + Intergenic
1156268094 18:35506386-35506408 AGCCAGGAAAGTGGTAACCTTGG - Intergenic
1158314192 18:56192433-56192455 TCCCAGGAAAATAGGCTCCCTGG - Intergenic
1160334748 18:78028998-78029020 CTCCAGGAATTTGGGAACCTGGG - Intergenic
1161585521 19:5103408-5103430 TCCCAGGAAAATGAGAAAGCGGG - Intronic
1162962379 19:14135947-14135969 CCCCATGAAAACGGGTACCTAGG + Intronic
1163383814 19:16986586-16986608 TCCCAGGAAACAGGCAGCCTTGG + Intronic
1163902974 19:20123364-20123386 TGGGAGGAAAATGGTAACCTGGG + Intronic
1164445550 19:28314639-28314661 TCTCTGGAAACTAGGAACCTAGG - Intergenic
1164461734 19:28454810-28454832 TACCAGGGACATGGGAACCCAGG + Intergenic
1164620011 19:29689795-29689817 TCCTAGGGAAATGGGAAGCAAGG + Intergenic
1166608453 19:44166382-44166404 TCCCAGGAGTTTGGGAAGCTGGG + Intronic
1167293025 19:48634975-48634997 TCCTAGGAATATAGGAAGCTTGG + Intronic
1168589227 19:57618885-57618907 GCCCAGAAAAATGGGATACTGGG - Intronic
924982234 2:234771-234793 TACCAGGAAGCTGTGAACCTGGG + Intronic
925674697 2:6349761-6349783 TCCCATAAAAATGTGAAACTTGG - Intergenic
927597233 2:24407406-24407428 TCCCAGGAAGCTGGGACCATAGG + Intergenic
927674060 2:25091534-25091556 TCCCAGAGAAACTGGAACCTGGG + Intronic
927684602 2:25161696-25161718 TCCCGGGAACATGGGAGTCTCGG + Exonic
928304004 2:30150703-30150725 TCCCAGAAAAAATGGAAACTTGG - Intronic
928427102 2:31188409-31188431 TCCCAGGAGAAGGGGAAGATTGG - Intronic
931591616 2:63889559-63889581 TCCCAGCAAAATAGGAAACGGGG + Intronic
931880076 2:66559295-66559317 TCCCAGGAAAGTGGGATGCATGG - Intronic
932293014 2:70598517-70598539 TCCCAGAGAAATGACAACCTAGG - Intergenic
933012658 2:77087916-77087938 CCTCTGGAAAAAGGGAACCTTGG - Intronic
933102991 2:78283786-78283808 TCCCAGGATAAATAGAACCTTGG - Intergenic
933145058 2:78841921-78841943 TCCCAGGAAAATGCCATCCAGGG + Intergenic
933491440 2:82990019-82990041 TCCCTGGAAAATGGGAAAATAGG - Intergenic
934633231 2:95954474-95954496 TCACTGGAAAATGGGAGTCTTGG + Intronic
934800269 2:97148804-97148826 TCACTGGAAAATGGGAGTCTTGG - Intronic
935463192 2:103363174-103363196 TCTCAGCAAAGTGGGAACGTGGG + Intergenic
936502134 2:113074762-113074784 CCCCAGGAAAATGGGGACCTTGG - Exonic
937032408 2:118751864-118751886 TCACAAGAAACTGGTAACCTTGG + Intergenic
937900495 2:127015947-127015969 TCCCGGGACAAGGGGATCCTGGG + Intergenic
938715320 2:134014775-134014797 TTCCACTAAAATGGGAACTTTGG + Intergenic
939832537 2:147089905-147089927 TGTCAGGAAAATGAGGACCTTGG - Intergenic
943178916 2:184516612-184516634 TCCCTAGAAAAGGGGAATCTGGG + Intergenic
944315125 2:198276530-198276552 TCCCAGGCAAAAGGGAACAATGG - Intronic
946387501 2:219393732-219393754 TCACAGTAAAATGGGAACCATGG - Intronic
946572823 2:221043090-221043112 TCTCAGTAAAATGAGAAGCTAGG - Intergenic
947048101 2:226011177-226011199 ACCCAGGAAAATGGGCATATAGG + Intergenic
947864116 2:233384378-233384400 GCCCAGGGAAATGGGAACCCAGG - Intronic
1169890506 20:10446470-10446492 TCCCAGAGAAATGAGAACTTAGG - Intronic
1170940899 20:20846980-20847002 TACCATGAAAATGGCAAGCTCGG - Intergenic
1171974535 20:31586085-31586107 TCCCAGCAACTTGGGAATCTGGG - Intergenic
1172726642 20:37048810-37048832 TCCCAGGTACTTGGGAAACTGGG + Intronic
1173851188 20:46219274-46219296 TCCCAGGAACAGGGGAGTCTTGG + Intronic
1173923019 20:46760123-46760145 TCCCTGGACAATGGGATCATGGG - Intergenic
1174121731 20:48271020-48271042 TCCCAGGGAACTGGGATGCTAGG - Intergenic
1176110182 20:63407499-63407521 TCCCAGGAAACGGGGGACCCAGG + Intronic
1176110221 20:63407611-63407633 TCCCAGGAAATGGGGGACCCAGG + Intronic
1176969488 21:15249158-15249180 TTGCAGGAAATTGGGAGCCTTGG + Intergenic
1177191255 21:17853634-17853656 TCCCAGTAAAACGGGAAACAAGG - Intergenic
1178299632 21:31441479-31441501 TCCCAGGAATATGGCAATGTTGG + Intronic
1179544529 21:42105412-42105434 TCCCTGCCAAATGAGAACCTCGG + Intronic
1183081763 22:35461323-35461345 TCCCAGGGACCAGGGAACCTTGG + Intergenic
1183273740 22:36878200-36878222 TCCCAGGAAAAGGGGAGCAGTGG - Intergenic
1183651277 22:39155254-39155276 TCCCAGCTACTTGGGAACCTGGG - Intergenic
1183885514 22:40878087-40878109 TCCCAGCTACTTGGGAACCTGGG + Intronic
1184611862 22:45609171-45609193 GCCCTGGAGAATGGGTACCTTGG + Intergenic
1184743607 22:46443374-46443396 CCCCAGGGAAATGGGAACAGAGG + Intronic
1184842932 22:47063201-47063223 TCCCATGAGATTGGGAACCCTGG - Intronic
950264255 3:11562787-11562809 TCCCAGGAAAATGGGCAGCTTGG + Intronic
951084567 3:18496318-18496340 TCCAAGGAAAATGGGCAACTTGG - Intergenic
951622400 3:24617272-24617294 TCCCAGCAAAAGGGGAATCTTGG + Intergenic
954407587 3:50354133-50354155 GCACAGGAAAATGGGCAGCTGGG + Intronic
954911390 3:54113765-54113787 TGCCAAGAAAAAGAGAACCTGGG - Intergenic
955484235 3:59419473-59419495 TACCAGGTGAATGGGAACCATGG - Intergenic
957803478 3:85116942-85116964 TCCCAGGAATTTGGGAATCTGGG + Intronic
960311569 3:116122826-116122848 TCACAGGTAACTGGAAACCTTGG + Intronic
960833614 3:121880257-121880279 TCCCAGCAACTTGGGAGCCTGGG - Intronic
963735607 3:149015022-149015044 TCCAAAGAAATTGGAAACCTGGG - Intronic
964605371 3:158555106-158555128 TCCCAGGAAAATAAGAAGCAAGG - Intergenic
966121585 3:176527832-176527854 CCCAAGGGAAAAGGGAACCTTGG - Intergenic
966198571 3:177338224-177338246 ACCCAAGAAAATGGGCACTTAGG - Intergenic
969227774 4:5810374-5810396 CCCCAGGAAAGAGGGGACCTGGG + Exonic
969498772 4:7540745-7540767 AGCCAGGAAATAGGGAACCTGGG - Intronic
969538225 4:7769797-7769819 TACCATGAAAATGGGCAGCTCGG + Intronic
973057702 4:45680722-45680744 TCCCAAGAAAGTGGGCATCTAGG + Intergenic
975059535 4:69979858-69979880 TCTCAGTAAAATGGGAAGCAAGG - Intergenic
976286942 4:83380117-83380139 TCCCAGGAGACTGGGAAGATAGG + Intergenic
981405535 4:144363394-144363416 TCACAGGAAAATAAGAAACTTGG - Intergenic
981690752 4:147506067-147506089 TGCCAGGATACTGGGAACCCAGG - Intronic
983029689 4:162784447-162784469 ACTCAGGAAATTGGGAACATTGG - Intergenic
983963736 4:173785720-173785742 TTGCAGGAAAATGGGTACCTAGG + Intergenic
984017900 4:174447525-174447547 TCCCATGAGAATGGGAGACTGGG - Intergenic
984279711 4:177655154-177655176 TCTCATTAAAATGTGAACCTTGG + Intergenic
984566134 4:181332415-181332437 TCCCAGGAAAGTGGCAAGGTTGG - Intergenic
986231930 5:5873230-5873252 TTCCAAGAAAATGAGAACCTTGG + Intergenic
990299075 5:54432648-54432670 TACCAGGAATCTGGGATCCTTGG + Intergenic
991215409 5:64153817-64153839 TCAGAGGAAAATGGGAATCCTGG - Intergenic
991575455 5:68098802-68098824 TCCCAGCAAATTGGGAATCTGGG + Intergenic
991593638 5:68279905-68279927 TCCCAAGCAAATGAGAATCTGGG - Intronic
993376277 5:87152697-87152719 TCCCAGTAGACTGGGAACTTAGG - Intergenic
994224168 5:97232788-97232810 CGCCAGGAAAAGGGGAACATGGG - Intergenic
994483418 5:100364317-100364339 TTCCACAAGAATGGGAACCTTGG - Intergenic
995222946 5:109671618-109671640 TTCCAGGAAATTAGGAAACTAGG - Intergenic
995999510 5:118341800-118341822 TCTCAGGAAAATAGGAAGCAAGG + Intergenic
996806556 5:127462120-127462142 TCTGAGGAAAATGGTGACCTGGG + Intronic
997342971 5:133160303-133160325 TCCCTGAAGAAAGGGAACCTAGG - Intergenic
997733955 5:136199940-136199962 TCCCAGATTAATGGGAGCCTGGG + Intergenic
999245300 5:150150955-150150977 TCTCAGGAAAATGGGCATGTGGG + Intronic
1000318010 5:160111515-160111537 TCCCAGGTACATGGGAGGCTGGG + Intronic
1001709359 5:173765550-173765572 CCCCAGGAATCTGGGAAACTTGG + Intergenic
1001727050 5:173912816-173912838 TCCCATGTAACTGGGAACATAGG - Intronic
1002866939 6:1130139-1130161 TCACTGAAACATGGGAACCTAGG + Intergenic
1002947608 6:1778191-1778213 TCCCAGCAAAATGAGACCCAAGG - Intronic
1004773348 6:18812227-18812249 CCCCAGGAGGATGAGAACCTGGG + Intergenic
1006096743 6:31660913-31660935 ACCCGGGAAAATGGGGAGCTGGG - Intergenic
1006259808 6:32858358-32858380 TCCCAGGTATATGGAACCCTGGG + Exonic
1006873052 6:37270780-37270802 CCCCAGGAAGATGAGAACCTAGG - Intronic
1007637500 6:43308147-43308169 AGCCAGGAATTTGGGAACCTGGG - Intronic
1009539955 6:64941853-64941875 TCCCATGTTGATGGGAACCTAGG + Intronic
1009640898 6:66334549-66334571 TCCCAGTAAATTAGGAAACTGGG - Intergenic
1010080880 6:71860497-71860519 TCTCAGGAAACTAGGAACATAGG - Intergenic
1010210169 6:73356346-73356368 TCACAGGAAAAAGGGAGCTTGGG - Intergenic
1012034567 6:94116776-94116798 TCTCAGGAAGCTGGGAACATAGG - Intergenic
1013636597 6:112034682-112034704 GCCCAGGAAAGTAGGAACATGGG + Intergenic
1016259783 6:142154453-142154475 TCCCAGGGAAATGGAAACTAGGG - Intronic
1017564623 6:155670096-155670118 TCACGGGGAAATGGCAACCTGGG - Intergenic
1017783254 6:157733099-157733121 TCCTAGGACAGTCGGAACCTTGG - Intronic
1018074767 6:160201894-160201916 TCCTGGGAACAAGGGAACCTGGG + Intronic
1019916008 7:4133085-4133107 TTCCAGGAACATGGGAACCAAGG - Intronic
1021555430 7:21913766-21913788 TCCCAGGGCAATGGGCATCTTGG + Intronic
1023520527 7:41046109-41046131 TCACAGGAAAGTGGGAAGCTGGG + Intergenic
1023632665 7:42179431-42179453 TCCAAGGGAAATGGGACCCTTGG + Intronic
1024024795 7:45400990-45401012 TCCCATGACAATGGGACCCGTGG + Intergenic
1024299922 7:47879203-47879225 TCTCAGGAGAAAGTGAACCTCGG + Intronic
1024706972 7:51971700-51971722 TTCCAGGATACTGGGAATCTTGG + Intergenic
1026062127 7:67035996-67036018 TCTGAGGACAATGGGAGCCTTGG - Intronic
1026675020 7:72420985-72421007 TCCCTGGAAATTGGGAAATTTGG - Intronic
1029274376 7:99395600-99395622 TCTCAGGAAAATGTGGGCCTTGG + Exonic
1029321980 7:99770390-99770412 TCCCAGGACACTGGGCATCTGGG - Intronic
1029690854 7:102180439-102180461 TCCCAAGTAACTGGGACCCTGGG + Intronic
1030415065 7:109232712-109232734 TCCAGGGAAAGTGGGAACTTGGG + Intergenic
1030497417 7:110316867-110316889 TTACAGGAAAATGGGAACATAGG + Intergenic
1031142001 7:117952872-117952894 TCCCAGGCCAATGGAAAGCTAGG - Intergenic
1032381398 7:131486481-131486503 TTCCAGGAAACTGGTATCCTTGG + Intronic
1032541339 7:132705622-132705644 CCACAGGGAAATGGGAACCAGGG - Intronic
1033651159 7:143345095-143345117 TCCCTGGAAAAAGGGAAACAAGG - Intronic
1034163268 7:149007587-149007609 TCCCAGCCCAAGGGGAACCTGGG - Intronic
1035359310 7:158299856-158299878 ACCCAGCAAAATGAGCACCTTGG + Intronic
1035555874 8:566657-566679 GCCCAGGAGCATGGGACCCTCGG + Intergenic
1036741409 8:11365024-11365046 TCCCTGGAGAATGTAAACCTTGG + Intergenic
1037645761 8:20791381-20791403 TCCTAGGAAGAGGCGAACCTGGG - Intergenic
1037838235 8:22227167-22227189 TCCCAGGAAAATGGTGGCCAGGG - Intronic
1038356700 8:26835918-26835940 TCCCAGGCAAAGGGAAACCTGGG - Intronic
1038407005 8:27329555-27329577 TCCCAGGTAAATGGCCACATTGG + Intronic
1038522854 8:28248187-28248209 TCTCACGAAATGGGGAACCTTGG - Intergenic
1038565675 8:28618453-28618475 TCGTTGGGAAATGGGAACCTGGG + Intronic
1040037725 8:42886769-42886791 TCCCAGCAACCTGGGAAGCTGGG + Intronic
1040123164 8:43704938-43704960 TCTCAGGAAGAGGGGATCCTAGG + Intergenic
1042268689 8:66934835-66934857 TCCCAGGAACCTGGAAACTTTGG + Intergenic
1043416350 8:80054471-80054493 TCCCAGGAAATTGAAAATCTAGG + Intronic
1044824364 8:96182466-96182488 AACCAGGCAAATGGGAAGCTGGG - Intergenic
1045833240 8:106489989-106490011 TCCCAGGCAAATTGGAATGTGGG + Intronic
1046684246 8:117206940-117206962 TCCCAGCACTTTGGGAACCTTGG + Intergenic
1047305335 8:123648494-123648516 TCTCTGGAAAGTGGGATCCTTGG + Intronic
1049704512 8:144034736-144034758 TCCCAGGTACTCGGGAACCTGGG - Intronic
1050584054 9:7091733-7091755 TGCCATGAAAATGGGAAGCAAGG + Intergenic
1052151956 9:25128035-25128057 TCCCAGCTAATTGGGAGCCTGGG + Intergenic
1052295127 9:26889552-26889574 TCCCAAGAAAATAGGGAACTCGG + Intronic
1053025587 9:34725890-34725912 TCCCATGAAAGTGGCAACCAGGG + Exonic
1053037115 9:34834952-34834974 TCCCATGAAAGTGGCAACCAGGG + Intergenic
1053461822 9:38277287-38277309 ACTCAGGAAAATGGGAACTTTGG + Intergenic
1055080202 9:72261305-72261327 CCACAGGCAAATGGGAACCTTGG - Intergenic
1056451818 9:86723720-86723742 TCTCAGGAATATGAGATCCTGGG + Intergenic
1056580814 9:87887153-87887175 TCCCAGGAAAATGGGAACCTTGG - Exonic
1057107326 9:92432022-92432044 TCCCATGAAAATGGTAATTTTGG + Intronic
1057305094 9:93907668-93907690 TCCAAGGGAACAGGGAACCTTGG - Intergenic
1058048439 9:100382322-100382344 TCCCAGGACTTTGGGAAGCTGGG + Intergenic
1059491949 9:114675403-114675425 TCCCACGAAATAGGGAACATGGG - Intergenic
1060371402 9:123076046-123076068 TCTCAGAAAAAGGGGAAGCTAGG + Intronic
1061859031 9:133458693-133458715 TCCCAGGACACTTGAAACCTCGG - Intronic
1062006996 9:134243936-134243958 TCTCAGCAAAAGGGGAACCGCGG + Intergenic
1062383172 9:136297511-136297533 TCCCAGGCAACTGGTGACCTTGG - Intronic
1185855317 X:3529021-3529043 TGCCAGTAAAATGGGAAACTAGG + Intergenic
1186269240 X:7866826-7866848 TCCTAGTAAAATGGGAAGCAAGG + Intergenic
1188592944 X:31862000-31862022 ACCCAGGAAACTGAAAACCTTGG + Intronic
1189334549 X:40162929-40162951 GACAAGGATAATGGGAACCTGGG + Intronic
1189497458 X:41521996-41522018 TTCCAGGAAATTGGGGCCCTGGG + Intronic
1189992241 X:46606486-46606508 TCCAAGGATTATGGGAAACTTGG - Exonic
1190003000 X:46707513-46707535 TGCCATGAATATGTGAACCTTGG - Intronic
1190290441 X:48988848-48988870 TCCCTAGAAACTGGGAACATGGG - Intronic
1190580445 X:51888621-51888643 TCCCAGAGAATTGGGAACTTAGG + Intronic
1190832644 X:54073211-54073233 TCCCAGGTAAATGGAAACAGTGG - Exonic
1192995168 X:76505640-76505662 TCCCAGGAAGTGGGCAACCTGGG + Intergenic
1195511797 X:105724112-105724134 GCACAGGAAATTGAGAACCTAGG - Intronic
1196123859 X:112079414-112079436 TACCAGGGAATTGGGAACCTTGG - Intronic
1198186818 X:134261057-134261079 TCCCAGGAAAAGTGTGACCTTGG + Intergenic
1198204712 X:134454899-134454921 TCCCAGGTACTTGGGAAGCTGGG - Intergenic
1198415907 X:136419444-136419466 ACCCAGGAATATGGGAAGGTTGG + Intergenic
1199257410 X:145732454-145732476 TCCAAGGAAAATGGAGACCTGGG - Intergenic
1199615394 X:149651696-149651718 TCCCAGGAAGATGGTGGCCTTGG - Intergenic
1200156162 X:153976735-153976757 TCCCAGGTAAATGGGACCACAGG - Intronic
1200799837 Y:7376452-7376474 TCCCAGCACTCTGGGAACCTGGG + Intergenic
1201451040 Y:14115693-14115715 TCCTAGTAAAATGGGAACCAAGG - Intergenic