ID: 1056581681

View in Genome Browser
Species Human (GRCh38)
Location 9:87891145-87891167
Sequence CGGGCCCACCAGAAGCTTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056581681_1056581688 11 Left 1056581681 9:87891145-87891167 CCTGAAAGCTTCTGGTGGGCCCG No data
Right 1056581688 9:87891179-87891201 GGCGTGCCTGACCACACTCCCGG No data
1056581681_1056581691 23 Left 1056581681 9:87891145-87891167 CCTGAAAGCTTCTGGTGGGCCCG No data
Right 1056581691 9:87891191-87891213 CACACTCCCGGTACTGACTGTGG No data
1056581681_1056581685 -10 Left 1056581681 9:87891145-87891167 CCTGAAAGCTTCTGGTGGGCCCG No data
Right 1056581685 9:87891158-87891180 GGTGGGCCCGGTGAGGACGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056581681 Original CRISPR CGGGCCCACCAGAAGCTTTC AGG (reversed) Intergenic
No off target data available for this crispr