ID: 1056581898

View in Genome Browser
Species Human (GRCh38)
Location 9:87894701-87894723
Sequence GAGACTGAGTGAGGTGCTAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056581898_1056581904 17 Left 1056581898 9:87894701-87894723 CCGGTAGCACCTCACTCAGTCTC No data
Right 1056581904 9:87894741-87894763 ATGGAGGTTTAATTCACCACTGG No data
1056581898_1056581902 -2 Left 1056581898 9:87894701-87894723 CCGGTAGCACCTCACTCAGTCTC No data
Right 1056581902 9:87894722-87894744 TCATTTCAGCTGGGTCAGTATGG No data
1056581898_1056581903 1 Left 1056581898 9:87894701-87894723 CCGGTAGCACCTCACTCAGTCTC No data
Right 1056581903 9:87894725-87894747 TTTCAGCTGGGTCAGTATGGAGG No data
1056581898_1056581905 18 Left 1056581898 9:87894701-87894723 CCGGTAGCACCTCACTCAGTCTC No data
Right 1056581905 9:87894742-87894764 TGGAGGTTTAATTCACCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056581898 Original CRISPR GAGACTGAGTGAGGTGCTAC CGG (reversed) Intergenic
No off target data available for this crispr