ID: 1056583490

View in Genome Browser
Species Human (GRCh38)
Location 9:87913010-87913032
Sequence CTGATAAACCATATCTGACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056583486_1056583490 28 Left 1056583486 9:87912959-87912981 CCTGTTAATAAAAAGACAGGGTA No data
Right 1056583490 9:87913010-87913032 CTGATAAACCATATCTGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056583490 Original CRISPR CTGATAAACCATATCTGACA AGG Intergenic
No off target data available for this crispr