ID: 1056583984

View in Genome Browser
Species Human (GRCh38)
Location 9:87916481-87916503
Sequence CTGATAAACCATATCTGACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056583980_1056583984 28 Left 1056583980 9:87916430-87916452 CCTGTTAATAAAAAGACAGGGTA No data
Right 1056583984 9:87916481-87916503 CTGATAAACCATATCTGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056583984 Original CRISPR CTGATAAACCATATCTGACA AGG Intergenic
No off target data available for this crispr