ID: 1056584968

View in Genome Browser
Species Human (GRCh38)
Location 9:87921832-87921854
Sequence CTGAGTACACAGCTCAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 2, 2: 6, 3: 23, 4: 215}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056584968_1056584979 26 Left 1056584968 9:87921832-87921854 CCTTCCTTGAGCTGTGTACTCAG 0: 1
1: 2
2: 6
3: 23
4: 215
Right 1056584979 9:87921881-87921903 GTTTTGGGCCAAACACAGGTGGG No data
1056584968_1056584978 25 Left 1056584968 9:87921832-87921854 CCTTCCTTGAGCTGTGTACTCAG 0: 1
1: 2
2: 6
3: 23
4: 215
Right 1056584978 9:87921880-87921902 GGTTTTGGGCCAAACACAGGTGG No data
1056584968_1056584980 27 Left 1056584968 9:87921832-87921854 CCTTCCTTGAGCTGTGTACTCAG 0: 1
1: 2
2: 6
3: 23
4: 215
Right 1056584980 9:87921882-87921904 TTTTGGGCCAAACACAGGTGGGG No data
1056584968_1056584973 10 Left 1056584968 9:87921832-87921854 CCTTCCTTGAGCTGTGTACTCAG 0: 1
1: 2
2: 6
3: 23
4: 215
Right 1056584973 9:87921865-87921887 AAGCCCATATTGTGAGGTTTTGG 0: 1
1: 7
2: 1
3: 14
4: 186
1056584968_1056584972 4 Left 1056584968 9:87921832-87921854 CCTTCCTTGAGCTGTGTACTCAG 0: 1
1: 2
2: 6
3: 23
4: 215
Right 1056584972 9:87921859-87921881 TGCTGGAAGCCCATATTGTGAGG 0: 1
1: 2
2: 1
3: 11
4: 111
1056584968_1056584977 22 Left 1056584968 9:87921832-87921854 CCTTCCTTGAGCTGTGTACTCAG 0: 1
1: 2
2: 6
3: 23
4: 215
Right 1056584977 9:87921877-87921899 TGAGGTTTTGGGCCAAACACAGG No data
1056584968_1056584974 11 Left 1056584968 9:87921832-87921854 CCTTCCTTGAGCTGTGTACTCAG 0: 1
1: 2
2: 6
3: 23
4: 215
Right 1056584974 9:87921866-87921888 AGCCCATATTGTGAGGTTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056584968 Original CRISPR CTGAGTACACAGCTCAAGGA AGG (reversed) Intergenic
900811370 1:4803797-4803819 CTGAGCAAACAGCTCAAGCATGG - Intergenic
901029577 1:6299148-6299170 CTGAGCCCACGGCTCAGGGAGGG - Intronic
901515330 1:9741469-9741491 CAGAGGACACAGCCCAAGTAGGG + Intronic
901634197 1:10663149-10663171 CTGACTACACAGCCAAGGGAAGG + Intronic
902652609 1:17846293-17846315 TTGAGGACACAGCACATGGAAGG - Intergenic
904789267 1:33006344-33006366 CTGAGGGCACAGCACAAGGGAGG - Intergenic
904880224 1:33690842-33690864 CAGAGACCACAGCTCCAGGAGGG + Intronic
906722688 1:48020520-48020542 CAGAGTAAAGAGCTCCAGGAGGG + Intergenic
907477171 1:54713532-54713554 ATGAGGACACAGCTTAATGAGGG + Intronic
908127369 1:61044366-61044388 CTGAGTAAACAAATCAAGGATGG + Intronic
910358637 1:86392709-86392731 CAGTGTACACTGCTCAGGGATGG + Intronic
911728335 1:101266009-101266031 CCGAGGACAATGCTCAAGGAGGG - Intergenic
913474491 1:119223729-119223751 GGGAGTCCCCAGCTCAAGGAGGG + Intergenic
914453855 1:147817136-147817158 CTGAGCAGAGAGCTCATGGAGGG + Intergenic
915234405 1:154469974-154469996 CTGTGTAAACAGTTCAGGGATGG + Intronic
916516061 1:165517768-165517790 CTGAGTACACACATAAAAGATGG + Intergenic
919357151 1:196538006-196538028 CTGGCTACACAGCTCAGGAAAGG - Intronic
920186024 1:204159989-204160011 CTGAGTTCACAGAAAAAGGAAGG + Intronic
922444251 1:225683262-225683284 ATGAGAACACAGCCCAAAGACGG + Intergenic
924563684 1:245178393-245178415 CTGAAGAGACAGCTCAAGAATGG - Intronic
1062887967 10:1033737-1033759 CTGAGCTCAGAGCTCAGGGATGG + Intergenic
1063175903 10:3550791-3550813 CTGAGTACACAGCCCCAACAAGG + Intergenic
1066933784 10:41801118-41801140 CTGAGTACATAACTAAATGAAGG - Intergenic
1067959091 10:50827534-50827556 CTGAGTACACAACGAAATGAAGG + Intronic
1068572684 10:58648284-58648306 ATGAGAACACAGTTCAAAGAGGG - Intronic
1068958184 10:62840040-62840062 GTGAGGACATAGCTCAAAGATGG - Intronic
1069411478 10:68158196-68158218 CTGAGCGCACAGCTTCAGGAGGG - Intronic
1069514648 10:69068082-69068104 CTGAGTCCAGAGTCCAAGGAAGG + Intergenic
1070452562 10:76576622-76576644 CTGAATGCAGAGCTCTAGGAAGG + Intergenic
1071905050 10:90163812-90163834 CTGAGTCCACAGCTTCGGGAGGG + Intergenic
1073041688 10:100612223-100612245 CTGAGATCAGAGGTCAAGGATGG + Intergenic
1073366014 10:102941656-102941678 CTGAGTACAGATCTGAAGGAAGG - Intronic
1073479246 10:103775841-103775863 TTCAGAACCCAGCTCAAGGACGG + Intronic
1076190343 10:128478910-128478932 CTGTGTAACCAGCTCAAGGCAGG - Intergenic
1076560195 10:131357775-131357797 CTGAGGACGCAGCTCCAGGCCGG + Intergenic
1076599297 10:131646716-131646738 CTGAGAACACACCACAAGGAAGG - Intergenic
1077283556 11:1756181-1756203 CTGAGTACCCAGGTCAGGGAGGG - Intronic
1083891252 11:65596770-65596792 CTGAGGACAGAGGCCAAGGAAGG + Intronic
1083955428 11:65980324-65980346 GAGAATACAGAGCTCAAGGAAGG - Intergenic
1084974205 11:72787708-72787730 CTGAGCACAGAGCTGAAGGGAGG - Intronic
1085422068 11:76371288-76371310 CTGAGTAAACAGCGCAGGGAAGG - Intronic
1085662412 11:78381042-78381064 TTGAGTACAAAGCTTAAGTATGG - Intronic
1086203570 11:84232643-84232665 GTGAGGACACAGCAGAAGGATGG + Intronic
1089894996 11:121921264-121921286 CTGAGTACTCAGCTCTGGGTGGG + Intergenic
1093483873 12:19631955-19631977 ATGAATACACAGCTCAAAGTGGG + Intronic
1093976703 12:25430960-25430982 CTAAATGCACAGCTCAAAGATGG + Intronic
1094809170 12:34121247-34121269 CTGACCACAGAGCTCAGGGAAGG - Intergenic
1095409218 12:41903945-41903967 CTGATTACATAGGTCTAGGATGG - Intergenic
1098307099 12:69113362-69113384 CTGAGGAGAGAGCTCAAGGCTGG - Intergenic
1099435345 12:82635480-82635502 CTGTGGATACAGCTCATGGAGGG - Intergenic
1101592331 12:106136003-106136025 CTGAGCACACTGCTCACAGATGG - Intronic
1102954664 12:117051764-117051786 CTCAGGACCCAACTCAAGGAAGG + Intronic
1107011704 13:35676864-35676886 ATCATTACACAGCTCAATGATGG - Intergenic
1107555437 13:41513480-41513502 CTGAGGACACAGCATGAGGACGG + Intergenic
1107664875 13:42678439-42678461 CTGAGATCACAGCTCGATGAAGG - Intergenic
1107905877 13:45060845-45060867 CTGAGCACACAGCTTCCGGAGGG - Intergenic
1112104957 13:96230546-96230568 CTGAGGAAACAGGTCAGGGAGGG + Intronic
1112356099 13:98675936-98675958 CCAAGCTCACAGCTCAAGGAAGG + Intergenic
1113017110 13:105840268-105840290 CTGAGGACACAGCCAGAGGAGGG + Intergenic
1114272425 14:21109821-21109843 CTGAGTACTCAGACCAAGAAGGG + Intergenic
1115762962 14:36594009-36594031 CTGAGTGCACAGCTTCAGGAGGG + Intergenic
1116395918 14:44448574-44448596 CTGAGTTCTCAGTTAAAGGAGGG + Intergenic
1120628847 14:86864176-86864198 CAGAGTACACTGCTCATGCATGG - Intergenic
1121230430 14:92353724-92353746 CTGACAACACAGCCCAAGTAGGG - Intronic
1123973859 15:25534248-25534270 ATGAATACACAGCTCAAAGCAGG + Intergenic
1125318082 15:38454043-38454065 CTGAGAGCACAGCTGAAGAAGGG - Intergenic
1125467465 15:39968427-39968449 CTGAGGAAACATCTCAAGAAGGG - Intronic
1126025422 15:44441692-44441714 CTGAGTCCTCAGCTCTCGGATGG + Intronic
1126249478 15:46551019-46551041 CTAATTACAAAGCTCAAAGAGGG - Intergenic
1126787028 15:52185727-52185749 ATGAATACACAGCTCAAAGTGGG - Intronic
1126832980 15:52628397-52628419 CTGAGTACACAGCCCTGGCATGG - Intronic
1126907581 15:53384462-53384484 CTGCTTACACGGCTCAGGGAAGG + Intergenic
1130063189 15:80584193-80584215 ATGAGTACACTGCTGGAGGAAGG + Intronic
1130836485 15:87654851-87654873 CTGAGCACACAGCTCCTGAAAGG + Intergenic
1131699374 15:94917606-94917628 CTGATTGCACAGCTCAAGTGTGG - Intergenic
1134123288 16:11599608-11599630 CTGAGTCCAGAGCTCAGGTAGGG - Intronic
1135086503 16:19478828-19478850 TTGGGTGCACAGCCCAAGGATGG - Intronic
1135151407 16:20009867-20009889 ATGAGAACACAGCCCAAGTATGG - Intergenic
1136451663 16:30357299-30357321 CTGAGAACACAGAGCAAGGTGGG + Exonic
1136654271 16:31700617-31700639 CAGGGTACACAGATCAAGCAGGG - Intergenic
1136779269 16:32886504-32886526 CGGTGGACAGAGCTCAAGGAAGG - Intergenic
1136891348 16:33975014-33975036 CGGTGGACAGAGCTCAAGGAAGG + Intergenic
1137071226 16:35906591-35906613 TTGAAAACACAGTTCAAGGATGG - Intergenic
1137495374 16:48965313-48965335 CTGTGTAGACAGATGAAGGAGGG + Intergenic
1138404648 16:56780137-56780159 CTGAGAAAACTGCACAAGGAGGG - Intronic
1138961373 16:62034434-62034456 CTGAGGTGACAGCCCAAGGAGGG + Intronic
1139496337 16:67321849-67321871 CTGAGCACGCAGCTTCAGGAGGG + Intronic
1139727052 16:68908771-68908793 CTGAGGTCTCAGTTCAAGGAAGG + Intronic
1139758973 16:69168957-69168979 CAGGGTAGACAGTTCAAGGAAGG - Exonic
1141916809 16:87103524-87103546 GTGACTACACAGCTTCAGGATGG - Intronic
1203081685 16_KI270728v1_random:1148592-1148614 CGGTGGACAGAGCTCAAGGAAGG - Intergenic
1145868370 17:28255160-28255182 TTGAGGACACAGCTCCAGGTGGG + Intergenic
1147575227 17:41595133-41595155 TAGAGTTCACAGCTCAAGGCTGG + Intergenic
1148649143 17:49237179-49237201 CTGGGTCCCCAGCCCAAGGACGG + Intergenic
1150798721 17:68261769-68261791 CTGCATACACATCTCAGGGAAGG + Intronic
1152531382 17:80921420-80921442 CTGAGTACACTGCTCAGTGGGGG - Intronic
1153531786 18:6054357-6054379 CTGACTCCACACCTCAGGGATGG - Intronic
1157152554 18:45232759-45232781 CTGTGTAGCCAGCTCAAGGCTGG + Intronic
1157799058 18:50603594-50603616 CTGAGTCCACAGCTGCAGAATGG + Intronic
1158097595 18:53791864-53791886 CTGAGTAGACAGGACAAGAAAGG - Intergenic
1159050735 18:63419049-63419071 CTGAGTACCCAACTCAGGTAGGG - Intronic
1159545062 18:69830472-69830494 GTGAGGACACAGCACAAAGATGG + Intronic
1159758851 18:72399402-72399424 CTGATTTCACAGCTACAGGAGGG + Intergenic
1160268409 18:77361227-77361249 CTGAGTTCAGAGCTCAATGAAGG - Intergenic
1161056924 19:2195341-2195363 AGGAGCACACAGGTCAAGGAAGG - Intronic
1162931211 19:13958817-13958839 CTCAGTAGACAGCTTAAGAAAGG + Intronic
1163313599 19:16528197-16528219 CAGAGTACGAAGCTCCAGGAGGG - Exonic
1163462493 19:17447619-17447641 CGGAGTCCTCAGCTCAAGGAGGG + Intronic
1164131556 19:22367446-22367468 CTGGGCACACAGCTAGAGGAAGG + Intergenic
1168059703 19:53883895-53883917 CAGAGCACAGAGCTCAGGGAAGG - Intronic
1168163678 19:54531522-54531544 CTGAGTACACACCCCAGGGTGGG - Intergenic
929831281 2:45348768-45348790 GTGACTACACAACTCAAGTAAGG + Intergenic
930774597 2:55159565-55159587 CTGGGTACTCAGCTAAGGGAGGG + Intergenic
931518607 2:63071143-63071165 CTGAGAAGACAGCCCAGGGAAGG - Intergenic
932282851 2:70509670-70509692 CTGAGTACCCAGCTCATGCAAGG + Intronic
932877003 2:75462944-75462966 TTAAGTACACAGCTCAACGGGGG - Intergenic
933783684 2:85820534-85820556 CTGAGCACACAGCTTCAAGAGGG + Intergenic
935047733 2:99497403-99497425 CTCTGTGCACAGCCCAAGGAAGG + Intergenic
935788988 2:106573775-106573797 TTGAGTACAAAGCTCAAGGATGG - Intergenic
936042744 2:109162023-109162045 CTGAGGACACATCCCAAGGAGGG - Intronic
936525702 2:113240186-113240208 GTCAGCACACAGCTCCAGGAAGG - Intronic
936735347 2:115435179-115435201 CTGGGTACACAGCCTAAGAAAGG - Intronic
937310576 2:120900331-120900353 CTGAATCCACAGGTCCAGGATGG + Intronic
937381511 2:121381694-121381716 CTGAGCACACAGATCCAGAAAGG - Intronic
937670402 2:124532125-124532147 GTGAGTACACAGCTCAAAGTGGG + Intronic
937772236 2:125733106-125733128 ATGAACACACAGCTCAAGGGGGG - Intergenic
938378164 2:130822212-130822234 TTGAGGCCCCAGCTCAAGGAGGG - Intergenic
938378180 2:130822296-130822318 TTGAGGCCCCAGCTCAAGGAGGG - Intergenic
938378196 2:130822380-130822402 TTGAGGCCCCAGCTCAAGGAGGG - Intergenic
938378212 2:130822464-130822486 TTGAGGCCCCAGCTCAAGGAGGG - Intergenic
940029003 2:149240794-149240816 CTGAGAACAAAGCTGTAGGAGGG - Intergenic
940540393 2:155009002-155009024 CTGAGTATAGAGTTCTAGGATGG - Intergenic
940765248 2:157783264-157783286 CTAAGTACACAGATGCAGGAAGG + Intronic
942368865 2:175259074-175259096 CTGAGTGCACAGACCAGGGAGGG - Intergenic
943510464 2:188819927-188819949 ATGAGTACACAGCTCAAAGCAGG + Intergenic
943873327 2:193030173-193030195 CTGAGTATATAGCCCAAAGAAGG + Intergenic
946273826 2:218615794-218615816 CTTAGTGTACAGCTCAGGGAAGG + Intronic
946425159 2:219590846-219590868 CTGAGCGCACAGCTTCAGGAGGG + Intergenic
947615487 2:231554470-231554492 CTGAGTACACAGACGAAGGAAGG - Intergenic
948618000 2:239213833-239213855 ATGAGTACACAGCTGGATGAGGG + Intronic
1172192783 20:33071962-33071984 CTGAGGACACAGCTCCTGGCAGG - Intronic
1173201876 20:40960625-40960647 CTGAGAACAGAGCCCCAGGATGG - Intergenic
1173426587 20:42948437-42948459 CTGAGTGAACAGCTCAGGGATGG + Intronic
1176028031 20:62996133-62996155 CTCAGGACGCAGCTCAATGACGG + Intergenic
1181863821 22:25839966-25839988 CTGAGCAGAGAGCTGAAGGAGGG - Intronic
1182164854 22:28162892-28162914 TGGAGTACACAGGCCAAGGATGG - Intronic
1183417593 22:37691428-37691450 ATGACTGCACAGCTCAAGGTTGG + Exonic
1184570715 22:45323071-45323093 GTGTGTACACAGCACAAGGCCGG + Intronic
1185104100 22:48857665-48857687 CTGAGTATGGAGCTCAGGGATGG - Intergenic
1185104137 22:48857815-48857837 CTGAGTATGGAGCTCAGGGATGG - Intergenic
1185104162 22:48857915-48857937 CTGAGTATGGAGCTCAGGGATGG - Intergenic
950656935 3:14442469-14442491 GTGAGGAAACAGCTCAAGGCTGG - Intronic
952820261 3:37480440-37480462 CTGAGGAGAAAGCTGAAGGAAGG - Intronic
953472428 3:43178603-43178625 CTGAGGCCAGAGCTCTAGGAGGG - Intergenic
954876696 3:53807073-53807095 CTGAGAACACAGGTGGAGGAGGG - Intronic
955327202 3:58018301-58018323 ATGAATACATAGCTCAAAGAGGG - Intronic
956703452 3:71979374-71979396 CAGATTACTTAGCTCAAGGAGGG + Intergenic
956710624 3:72035613-72035635 CTGATTGCACAGATGAAGGAAGG - Intergenic
960425280 3:117499411-117499433 CTGAGTACACAGCTGAATGTGGG + Intergenic
965036454 3:163445248-163445270 CAGTGTACACTGCTCAGGGATGG - Intergenic
966502352 3:180657563-180657585 ATGAGTACACAGCTCATAAAAGG - Intronic
967224999 3:187282608-187282630 GTGAGTTCTCAGCTCTAGGAGGG + Intronic
967240984 3:187439415-187439437 GTAAGTACACAGGTCAAGCAAGG - Intergenic
969370592 4:6728761-6728783 CTGAGGACACAGGGCAAGCAGGG - Intergenic
969443585 4:7231991-7232013 GTCAGAACACAGCTCCAGGATGG - Intronic
971060806 4:22967039-22967061 CTGAGCACACAGCTCACTGAAGG + Intergenic
972556696 4:40188842-40188864 CTGATTACAAAGATCAAGGGAGG + Intergenic
973909765 4:55567566-55567588 ATGAATACATAGGTCAAGGAGGG - Intronic
975528191 4:75373947-75373969 CTGAGGACACAGCTAGAGGGAGG + Intergenic
978313698 4:107413792-107413814 CTCTGTGCACAGATCAAGGAAGG + Intergenic
978845856 4:113271891-113271913 CTGAGGACACTGGACAAGGAAGG - Intronic
979999336 4:127470384-127470406 CTGAGCACAGAGATCAAGGCCGG - Intergenic
980659491 4:135839207-135839229 CTGTTTACACAGGTCAAGTAAGG - Intergenic
982035899 4:151345461-151345483 CTAAGTACTCAGCTCAGTGAAGG - Intergenic
982070384 4:151689093-151689115 CCCAGTTCACAGCTCAGGGATGG - Intronic
983647133 4:170003420-170003442 CTCAATACACAGATGAAGGAGGG + Intronic
985099513 4:186444489-186444511 CTGAGTGGACAGCTGTAGGAGGG + Intronic
986324573 5:6662290-6662312 GAGAGCACACAGCTCATGGAGGG - Intronic
986347485 5:6848324-6848346 CCGAGCACACAGCTTCAGGAGGG + Intergenic
989784893 5:45315315-45315337 CTGGGTACACAGCGAAATGAAGG + Intronic
991422948 5:66460011-66460033 CTGAGGCCACAGTTCATGGAAGG - Intergenic
992332114 5:75728189-75728211 TTGAATACATAGCTCAAAGAAGG + Intergenic
997864100 5:137445438-137445460 CTGAGTGCCCAGCACATGGAAGG - Intronic
998502285 5:142644154-142644176 GTGAGTTCACTGCTCAAAGAAGG - Intronic
998771254 5:145548645-145548667 CTGGGTAGACACCACAAGGATGG - Intronic
1000380422 5:160624071-160624093 CTGAGTTCACAGCTAAATCACGG + Intronic
1001563719 5:172686413-172686435 CTGAGCATACAGCTGAGGGAAGG - Intronic
1002255745 5:177957490-177957512 CTGAGGACACAGGACAAGGCAGG + Intergenic
1003293316 6:4801744-4801766 CAGAGTACAGAGCTCAAAGCTGG - Intronic
1003419749 6:5946402-5946424 CTGAGCACACAGTCCAGGGAAGG - Intergenic
1004332679 6:14736032-14736054 CTGAGGACAGAGCACATGGAGGG - Intergenic
1005482320 6:26266371-26266393 ATGAATACATAGCTCAAAGAGGG + Intergenic
1005984743 6:30864365-30864387 CTGAGCACACAGCTTCAGGAGGG - Intergenic
1006419196 6:33922988-33923010 CTCAGTAGGCAGTTCAAGGAGGG - Intergenic
1006929425 6:37678738-37678760 CTCAGAAGACAGCTGAAGGAAGG - Intronic
1007745500 6:44040750-44040772 CTGTGTACCCAGCTGAGGGAAGG - Intergenic
1007800274 6:44386503-44386525 GTGGGTAAACAGCTCAAGGGCGG + Intergenic
1011259724 6:85458339-85458361 CTGAGGCCACAGCCCCAGGATGG - Intronic
1011743639 6:90387965-90387987 AGGAGAACACAGCTCAAGGCAGG - Intergenic
1015451372 6:133370933-133370955 CTCAGTACACATCTAAAGGAAGG - Intronic
1018771474 6:166974831-166974853 CTGATTACTTAGCTCAAGGCGGG - Intergenic
1019034046 6:169040026-169040048 CTGAGTCCAGGGCTCAGGGATGG - Intergenic
1020812529 7:12864414-12864436 CTGAGTTCACAGCTGCAGAAGGG + Intergenic
1024225730 7:47325434-47325456 CAGAGAACACTGCTCAAGGAAGG + Intronic
1025165100 7:56705440-56705462 GTGATTACATAGCTCAAGGGGGG - Intergenic
1025240656 7:57269373-57269395 ATGATTACATAGCTCAAGGGGGG + Intergenic
1025705193 7:63856674-63856696 GTGATTACATAGCTCAAGGGAGG + Intergenic
1025803153 7:64806669-64806691 ATAAATACACAGCTCAAAGAAGG - Intronic
1026183467 7:68062467-68062489 GTGAATACATAGCTCAAAGAAGG - Intergenic
1027196609 7:76034915-76034937 CTCAGTAGACAGGTCAAGGTGGG - Intronic
1035934257 8:3819219-3819241 TTGACTACACAGCCCAAAGAGGG - Intronic
1036079732 8:5542077-5542099 CTGTGGACAGAGCTCAATGATGG + Intergenic
1036499225 8:9297887-9297909 CTGTTTACACAGCTCAAAGCAGG + Intergenic
1037219082 8:16495350-16495372 CTGAGTACACAGCAAGAAGACGG + Intronic
1042088416 8:65132777-65132799 CTCTGTGCACAGATCAAGGAAGG - Intergenic
1042634862 8:70862866-70862888 CTGTGTACTCAGGCCAAGGAAGG + Intergenic
1047773022 8:128045757-128045779 CAGATGACACTGCTCAAGGATGG + Intergenic
1048979665 8:139696619-139696641 CTGAGTACACAGAGGAGGGAGGG + Intronic
1049030668 8:140035042-140035064 CTGTATACACAGCTGGAGGAGGG + Intronic
1049065088 8:140307071-140307093 CTGAGTACATAACTCCATGAGGG + Intronic
1049939621 9:532899-532921 TTGTGTACACAGCTGCAGGAGGG + Intronic
1050492018 9:6198090-6198112 CAGAGAACACAGCTCTAGGAAGG - Intergenic
1053576438 9:39360134-39360156 CTGAGTACACGGCTCGAGGAAGG - Exonic
1053840948 9:42188059-42188081 CTGAGTACACGGCTCGAGGAAGG - Exonic
1054098008 9:60918825-60918847 CTGAGTACACGGCTCGAGGAAGG - Intergenic
1054119409 9:61194455-61194477 CTGAGTACACGGCTCGAGGAAGG - Exonic
1054588345 9:66988107-66988129 CTGAGTACACGGCTCGAGGAAGG + Intergenic
1055251689 9:74315307-74315329 CTCAGTTCACATCTGAAGGAAGG - Intergenic
1055604697 9:77956630-77956652 GTGAGTACAGAGCCCCAGGAAGG + Intronic
1055986374 9:82059301-82059323 CTGAGTACACGGCTCAAGGAAGG + Intergenic
1056584968 9:87921832-87921854 CTGAGTACACAGCTCAAGGAAGG - Intergenic
1056611914 9:88131108-88131130 CTGAGTACACGGCTCAAGGAAGG + Intergenic
1057160796 9:92886888-92886910 TTGAGTACATGGCTCAAGGAAGG - Intergenic
1059382301 9:113935765-113935787 CTGAGTACACAGCACAGGGCAGG - Intronic
1060726406 9:126008792-126008814 ATAAGTACACAGCCCATGGAAGG + Intergenic
1061212606 9:129202590-129202612 CTGAGCACACAGCCCAGGCAGGG - Intergenic
1062280148 9:135748240-135748262 CTGGTTACAGAGCTCAAGAAGGG - Intronic
1186421881 X:9433095-9433117 ATGGGGACACAGCCCAAGGATGG - Intergenic
1187048431 X:15672953-15672975 CTGAGTACACAGCCCCACAATGG - Intergenic
1188039683 X:25357516-25357538 CTGAGTACATACCCCAAGGTAGG - Intergenic
1190336215 X:49264020-49264042 CTGTGTACAAAGCTCTAGGCTGG + Intronic
1191060791 X:56293851-56293873 CTGAGTACACAACGAAATGAAGG + Intergenic
1191693479 X:63964428-63964450 CTGTGTAAATAGCTGAAGGAAGG - Intergenic
1193533057 X:82679439-82679461 CTGAGGACACAGCAAAAAGATGG + Intergenic
1197769554 X:130081578-130081600 CTGGCAACAGAGCTCAAGGAAGG - Intronic
1199021441 X:142882766-142882788 CTGAGTAAACACGTCAAGAAGGG + Intergenic
1201486165 Y:14496607-14496629 CTGAGGTCTCAGGTCAAGGAAGG + Intergenic