ID: 1056585040

View in Genome Browser
Species Human (GRCh38)
Location 9:87922207-87922229
Sequence CAGCTGGACAGGAGGGCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056585027_1056585040 26 Left 1056585027 9:87922158-87922180 CCGCGAGGGATCCCATCTTCAAA 0: 1
1: 1
2: 0
3: 12
4: 65
Right 1056585040 9:87922207-87922229 CAGCTGGACAGGAGGGCAGGTGG No data
1056585034_1056585040 -8 Left 1056585034 9:87922192-87922214 CCTTGAAGGCTCCTACAGCTGGA No data
Right 1056585040 9:87922207-87922229 CAGCTGGACAGGAGGGCAGGTGG No data
1056585030_1056585040 15 Left 1056585030 9:87922169-87922191 CCCATCTTCAAATGATCATGGGT 0: 1
1: 1
2: 3
3: 10
4: 105
Right 1056585040 9:87922207-87922229 CAGCTGGACAGGAGGGCAGGTGG No data
1056585025_1056585040 28 Left 1056585025 9:87922156-87922178 CCCCGCGAGGGATCCCATCTTCA 0: 1
1: 1
2: 0
3: 2
4: 48
Right 1056585040 9:87922207-87922229 CAGCTGGACAGGAGGGCAGGTGG No data
1056585026_1056585040 27 Left 1056585026 9:87922157-87922179 CCCGCGAGGGATCCCATCTTCAA 0: 1
1: 1
2: 0
3: 3
4: 48
Right 1056585040 9:87922207-87922229 CAGCTGGACAGGAGGGCAGGTGG No data
1056585031_1056585040 14 Left 1056585031 9:87922170-87922192 CCATCTTCAAATGATCATGGGTC 0: 1
1: 1
2: 2
3: 12
4: 100
Right 1056585040 9:87922207-87922229 CAGCTGGACAGGAGGGCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056585040 Original CRISPR CAGCTGGACAGGAGGGCAGG TGG Intergenic
No off target data available for this crispr