ID: 1056585854

View in Genome Browser
Species Human (GRCh38)
Location 9:87926679-87926701
Sequence CTGTAGCCTTTCCATACTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056585854_1056585866 18 Left 1056585854 9:87926679-87926701 CCCTCAGTATGGAAAGGCTACAG No data
Right 1056585866 9:87926720-87926742 GCCCATGGGAGCAGCCATGGGGG No data
1056585854_1056585865 17 Left 1056585854 9:87926679-87926701 CCCTCAGTATGGAAAGGCTACAG No data
Right 1056585865 9:87926719-87926741 AGCCCATGGGAGCAGCCATGGGG No data
1056585854_1056585864 16 Left 1056585854 9:87926679-87926701 CCCTCAGTATGGAAAGGCTACAG No data
Right 1056585864 9:87926718-87926740 CAGCCCATGGGAGCAGCCATGGG No data
1056585854_1056585863 15 Left 1056585854 9:87926679-87926701 CCCTCAGTATGGAAAGGCTACAG No data
Right 1056585863 9:87926717-87926739 CCAGCCCATGGGAGCAGCCATGG No data
1056585854_1056585857 3 Left 1056585854 9:87926679-87926701 CCCTCAGTATGGAAAGGCTACAG No data
Right 1056585857 9:87926705-87926727 CTCCACACCAGCCCAGCCCATGG No data
1056585854_1056585858 4 Left 1056585854 9:87926679-87926701 CCCTCAGTATGGAAAGGCTACAG No data
Right 1056585858 9:87926706-87926728 TCCACACCAGCCCAGCCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056585854 Original CRISPR CTGTAGCCTTTCCATACTGA GGG (reversed) Intergenic
No off target data available for this crispr