ID: 1056586124

View in Genome Browser
Species Human (GRCh38)
Location 9:87928346-87928368
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 392
Summary {0: 5, 1: 0, 2: 1, 3: 24, 4: 362}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056586124_1056586130 5 Left 1056586124 9:87928346-87928368 CCAAGCTGCATCTGTGCATTTTC 0: 5
1: 0
2: 1
3: 24
4: 362
Right 1056586130 9:87928374-87928396 TGGCTGGAGCTGGAGCTGCAGGG No data
1056586124_1056586132 28 Left 1056586124 9:87928346-87928368 CCAAGCTGCATCTGTGCATTTTC 0: 5
1: 0
2: 1
3: 24
4: 362
Right 1056586132 9:87928397-87928419 ATGTAGGCAGCAGTGCCCTGAGG No data
1056586124_1056586129 4 Left 1056586124 9:87928346-87928368 CCAAGCTGCATCTGTGCATTTTC 0: 5
1: 0
2: 1
3: 24
4: 362
Right 1056586129 9:87928373-87928395 ATGGCTGGAGCTGGAGCTGCAGG 0: 16
1: 82
2: 260
3: 481
4: 1162
1056586124_1056586131 12 Left 1056586124 9:87928346-87928368 CCAAGCTGCATCTGTGCATTTTC 0: 5
1: 0
2: 1
3: 24
4: 362
Right 1056586131 9:87928381-87928403 AGCTGGAGCTGCAGGGATGTAGG No data
1056586124_1056586127 -5 Left 1056586124 9:87928346-87928368 CCAAGCTGCATCTGTGCATTTTC 0: 5
1: 0
2: 1
3: 24
4: 362
Right 1056586127 9:87928364-87928386 TTTTCAGCCATGGCTGGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056586124 Original CRISPR GAAAATGCACAGATGCAGCT TGG (reversed) Intergenic
900606937 1:3527929-3527951 GAAAATGCACAGGCCCAGGTCGG + Intronic
900833805 1:4984844-4984866 CAGAACTCACAGATGCAGCTTGG - Intergenic
900928599 1:5721417-5721439 GGCAAGGCACAGATGCAGATTGG - Intergenic
901567720 1:10132465-10132487 AAGAAAGCACAGATGCAGGTAGG + Exonic
901819092 1:11814709-11814731 GAAGAGGCACAGATTCAGCTTGG - Intronic
901848402 1:11999327-11999349 GAAGATGCACTAATGCAGCAGGG - Intronic
902517808 1:16999083-16999105 GAAACAGCTCAGATGCAGCCAGG + Intronic
902543029 1:17167679-17167701 GAAAATGCAGAGAGGAAGATGGG + Intergenic
904525762 1:31132716-31132738 AAAATTGCAAAGATGCAGCCAGG + Intergenic
905357492 1:37394944-37394966 GAGAAAGCACAGAAGCAGCAAGG + Intergenic
905921907 1:41725237-41725259 GGACATGCAGACATGCAGCTGGG + Intronic
907346164 1:53782566-53782588 GAAACTGTACAGAAGCAGCAAGG + Intronic
908080385 1:60571259-60571281 GAAAAAAGACACATGCAGCTAGG + Intergenic
909085691 1:71167702-71167724 GAAGCTGCACAGATCCTGCTTGG + Intergenic
909222101 1:72978434-72978456 GAGAAAGCACAGTTGCAGATTGG + Intergenic
909626186 1:77718718-77718740 GAAAATGCAGAGATCCAGCCTGG + Intronic
910526215 1:88181546-88181568 GATAGTGCACAGATGTTGCTCGG - Intergenic
911176317 1:94821001-94821023 GGAAATGCACAGATACGGCATGG + Exonic
913014388 1:114717956-114717978 AATAATGCACAGTTGCAGCCTGG - Exonic
913066599 1:115261404-115261426 GAAAATGCACAGGAGCATTTGGG + Intergenic
913420532 1:118663147-118663169 GAAAATAAACAGATGAATCTAGG + Intergenic
916567199 1:165991368-165991390 TAAAATGCATAGCTGCAACTAGG + Intergenic
917476408 1:175373065-175373087 AAACATGCACAGAAGCAGCATGG + Intronic
919245525 1:194978113-194978135 AAAAATACACATATGCGGCTGGG - Intergenic
919628671 1:199937779-199937801 GAAAGTGGTCAGATGCAGGTTGG - Intergenic
921522858 1:216177920-216177942 GAAAGTCCACAGATGTAGTTTGG - Intronic
921606783 1:217165337-217165359 GTAAATGCACAGAGGCAAGTTGG + Intergenic
921621762 1:217333288-217333310 GAAAGAGAACAAATGCAGCTGGG + Intergenic
921925325 1:220706217-220706239 GAAGATGCCCAGATTCAGCTAGG - Intergenic
922172419 1:223166957-223166979 GAAAATGCCAAGATCTAGCTGGG - Intergenic
922569824 1:226627812-226627834 GAAAATGGACTAATGCAGGTGGG - Intergenic
922818214 1:228466306-228466328 GAAAGTGCACAGATGGACCCAGG - Intergenic
923641876 1:235771469-235771491 GAATATGCTCAGTTGCAGGTTGG - Intronic
924809892 1:247391736-247391758 GGAAATGCACAGATGGGTCTAGG - Intergenic
1063484883 10:6410555-6410577 GGAAATGCACAGGGGCATCTGGG + Intergenic
1064087054 10:12353030-12353052 GAAAGTACACAGAGGCGGCTGGG - Intronic
1064423901 10:15213498-15213520 GAAAAGGCCCTGATGGAGCTTGG - Exonic
1064943422 10:20760395-20760417 GCACATCCACAGATTCAGCTGGG - Intergenic
1065933741 10:30501918-30501940 GAAAAATCACAGAAGAAGCTGGG - Intergenic
1066503923 10:36022425-36022447 GAAAAGGCCCAGATGCAGCAAGG + Intergenic
1066808604 10:39293215-39293237 GAATCTGCACAGATATAGCTGGG - Intergenic
1068765440 10:60758173-60758195 GAAAATACAAAGATAAAGCTAGG + Intergenic
1069485563 10:68820581-68820603 GAAAATGTACATATGCACCATGG - Intergenic
1069600735 10:69705182-69705204 GAAAATGTAAAGATCCAGCCTGG - Intergenic
1070557410 10:77539303-77539325 GATAATGCAGAGATGGAGATGGG + Intronic
1071223111 10:83492987-83493009 GAAAGTGCACAGATGGGCCTAGG + Intergenic
1071248767 10:83793438-83793460 GAAAATGCAGGGATTCATCTGGG - Intergenic
1071283949 10:84127031-84127053 GAAAGGGCAGAGATGCAGGTAGG - Intergenic
1072195058 10:93110386-93110408 AAATCTGCACAGATGCAGCCAGG - Intergenic
1072883810 10:99255822-99255844 GAAAATGGACTAATGCAACTGGG - Intergenic
1074058896 10:109946948-109946970 GAAGATGCACAGATGAATCGTGG - Intronic
1074404403 10:113168782-113168804 GAAAATGCACATAAACAGCTTGG - Intergenic
1074666991 10:115738531-115738553 GAAAATTCCAAAATGCAGCTGGG - Intronic
1075032137 10:119030427-119030449 GAACACGCACACCTGCAGCTCGG - Exonic
1075388505 10:122075308-122075330 GCACCTGCACTGATGCAGCTTGG - Intronic
1075825991 10:125357392-125357414 GAAAATGGACTAATACAGCTGGG - Intergenic
1076243774 10:128930375-128930397 AAAAATGCACAGTGGCAGATTGG - Intergenic
1076544967 10:131239020-131239042 GAAAATGCACACGTGCTACTTGG - Intronic
1077265508 11:1647088-1647110 GAAAATGCAAAGAACCGGCTGGG - Intergenic
1077997364 11:7465671-7465693 GAAAATGGACTAATACAGCTGGG - Intronic
1078159041 11:8824560-8824582 GAAAATGTACATATACAGCATGG - Intronic
1078560919 11:12371719-12371741 GAAAATGCACATATACACCATGG + Intergenic
1079927759 11:26516593-26516615 GAAAATGCACTAATGCACATAGG + Intronic
1080859723 11:36142728-36142750 GAAAATGCCTGGCTGCAGCTGGG - Intronic
1081224582 11:40504443-40504465 GAATATGAACAGATGCCACTTGG + Intronic
1082703845 11:56468049-56468071 GAAAATGCACATATACATCATGG + Intergenic
1084461027 11:69296677-69296699 GAAAATGACCAGAAGGAGCTGGG - Exonic
1084680845 11:70665433-70665455 GAAAATTCTCAGATGGAGCAGGG - Intronic
1086451146 11:86918216-86918238 GTAAATGCAGAGATGAAGCTTGG + Intronic
1088782800 11:113152309-113152331 AGAAATGCACAGATGCAGTATGG - Intronic
1091370997 11:135057718-135057740 GAAAAGACACAGAAGCTGCTGGG - Intergenic
1092567094 12:9678016-9678038 GGAAATGCACAGATCCAGCAGGG - Intronic
1094502844 12:31036145-31036167 GAAGATGCACTGCTGCTGCTGGG - Intergenic
1097827314 12:64187373-64187395 GAAAATGGAGAGATGCAAATGGG - Intronic
1098278421 12:68837245-68837267 CAAAATGTACAAATTCAGCTGGG - Intronic
1100751366 12:97701934-97701956 GGAAATGCACAGATGGGCCTAGG - Intergenic
1101071727 12:101082397-101082419 GAAAATGGACAGATACATCCAGG + Intronic
1101153840 12:101908779-101908801 GGAAGTGCACAGATGGACCTAGG + Intronic
1103075350 12:117977971-117977993 TAAAAAGCACACATGCAGCCAGG + Intergenic
1104487565 12:129164485-129164507 GAAAATGGACCAATACAGCTGGG - Intronic
1104653088 12:130551676-130551698 GAAAATGCACAGATAGAGCAAGG + Intronic
1105259864 13:18771012-18771034 AAAGATGCACAGGTACAGCTTGG - Intergenic
1105262544 13:18790335-18790357 AAAGATGCACAGGTACAGCTTGG - Intergenic
1105264465 13:18803791-18803813 AAAGATGCACAGGTACAGCTTGG - Intergenic
1105818708 13:24060765-24060787 AAAAATGGACAAATGCGGCTGGG + Intronic
1106134164 13:26961908-26961930 GAAGGTGCACAGAGGCAGCATGG - Intergenic
1106809846 13:33349508-33349530 GAGCATGCACAGAAGCAGCAAGG + Intronic
1107140451 13:36993012-36993034 GAAGATGCACAGCCTCAGCTGGG + Intronic
1107553686 13:41499353-41499375 GAGAAGGCACAGAACCAGCTTGG - Intergenic
1107843825 13:44489920-44489942 GAACATTCACAGACACAGCTAGG + Intronic
1107963355 13:45578044-45578066 GGAAGTGCACAGATGGACCTAGG - Intronic
1107966194 13:45600313-45600335 GGAAGTGCACAGATGAATCTGGG - Intronic
1108671298 13:52691853-52691875 AAAAATGCACAGATGGAGAAAGG - Intronic
1108975385 13:56437215-56437237 GAAAATGGAGAGATGTAGTTTGG + Intergenic
1111532238 13:89552944-89552966 CTAAATGCACAGATGCAACTTGG - Intergenic
1114919882 14:27312858-27312880 CAAAATGCACAAATGAAGCAAGG - Intergenic
1116749851 14:48869480-48869502 GAAAATTCAAAGAAGCAGCAGGG + Intergenic
1116788439 14:49313367-49313389 GAATATGCACAGCTCCAGATTGG - Intergenic
1118157399 14:63255314-63255336 GGAAATGCAGAGAGGCAACTGGG - Intronic
1118523236 14:66611019-66611041 GAAAGTGCACAGATGGGCCTAGG + Intronic
1119032009 14:71200142-71200164 CAAGATGCACAGATGCAGTAAGG + Intergenic
1121181931 14:91935506-91935528 GAAAATGCAGAGATAGAGGTGGG - Intronic
1122308937 14:100782696-100782718 GAAATGGCCCAGTTGCAGCTGGG + Intergenic
1202833982 14_GL000009v2_random:64277-64299 AAAGATGCACAGGTACAGCTTGG + Intergenic
1124009024 15:25820700-25820722 GAAAATTCAAAAATGCTGCTTGG + Intronic
1125688884 15:41580590-41580612 GAAAATGCAAATATTCAGCTGGG + Exonic
1126779981 15:52131119-52131141 TAAAATGCACACACTCAGCTGGG - Intronic
1127829166 15:62735183-62735205 GAAATTTCACAGATGAAGCCTGG - Intronic
1128367860 15:67017396-67017418 AAAAAAGAAAAGATGCAGCTGGG + Intergenic
1129025264 15:72566239-72566261 AAAAATGCACTGATGAAGCATGG + Intronic
1133019696 16:2961905-2961927 GCAGATGCACAGGTGCAGATTGG - Intergenic
1133970563 16:10564764-10564786 GGAAATGCAAACAGGCAGCTCGG + Intronic
1135830072 16:25765306-25765328 GAAAATGCGGAGACGCCGCTGGG + Intronic
1137649909 16:50110864-50110886 GAAAATGCTAAGATGACGCTTGG + Intergenic
1138635225 16:58332969-58332991 TAAAAAACACAGATGCAGCCGGG - Intronic
1138761597 16:59550425-59550447 GGAAATGCACAGATGAGCCTAGG + Intergenic
1139326502 16:66156467-66156489 GGAAATGCACAGCTGCAGTCTGG + Intergenic
1139823790 16:69741078-69741100 AAAAAAGCACAGATGGGGCTGGG + Intergenic
1140852390 16:78947348-78947370 GAAAAATAACAAATGCAGCTAGG - Intronic
1141280017 16:82622940-82622962 CAAAGGGCACAGATGCAGGTTGG + Intergenic
1142585279 17:968410-968432 AAAGATACACAGATGCAGCCCGG + Intronic
1143392769 17:6569806-6569828 GAAACTGCACAGAAGGGGCTGGG + Intergenic
1143704785 17:8689158-8689180 AAAAATGCACAAAACCAGCTGGG - Intergenic
1145415715 17:22712136-22712158 GAAAAGGCAGAGTTGAAGCTGGG - Intergenic
1147269076 17:39254520-39254542 AACCATGCCCAGATGCAGCTGGG + Intergenic
1147326401 17:39671761-39671783 GAACATGCACACAGGCAGCCTGG + Exonic
1148627775 17:49083150-49083172 AAAAACACCCAGATGCAGCTGGG - Intergenic
1149075103 17:52587405-52587427 GAAAACACACACATGCAGCTGGG + Intergenic
1149308828 17:55374487-55374509 GAAAATGGACTAATACAGCTGGG + Intergenic
1149720631 17:58840576-58840598 GAAAATGTACAGAACCAGCCTGG + Intronic
1150921952 17:69493463-69493485 AAAAATACTCAGCTGCAGCTGGG + Intronic
1151607531 17:75148459-75148481 CAACAGCCACAGATGCAGCTTGG - Intronic
1152254065 17:79227276-79227298 GAACATCCACAGAGGCAGGTTGG + Intronic
1152684443 17:81687196-81687218 GAAAATGTGCAGGTGCAGATCGG + Intronic
1153116993 18:1670368-1670390 TAAAATGGACAGATTCATCTTGG + Intergenic
1153235793 18:2985977-2985999 GAAAATGCAGAAATGCACTTAGG - Intronic
1153472982 18:5467910-5467932 CCAAATCCACAGCTGCAGCTGGG - Intronic
1154257725 18:12798616-12798638 GAAAATGTACATATACAGCATGG - Intronic
1154381213 18:13851756-13851778 AAAAATACAAAGAAGCAGCTAGG + Intergenic
1154423924 18:14257770-14257792 AAAGATGCACAGGTACAGCTTGG + Intergenic
1154427992 18:14286811-14286833 AAAGATGCACAGGTACAGCTTGG + Intergenic
1154428893 18:14293379-14293401 AAAGATGCACAGGTACAGCTTGG + Intergenic
1154431170 18:14309718-14309740 AAAAATGCACAGGTACAGCTTGG + Intergenic
1154433847 18:14329023-14329045 AAAGATGCACAGGTACAGCTTGG + Intergenic
1155918380 18:31578150-31578172 GAAAATGAACAAATGCAGGTGGG + Intergenic
1156182911 18:34626768-34626790 GAAGCTACACAGATGCAGCCTGG + Intronic
1158271578 18:55722048-55722070 GAAAATGCTCAAACTCAGCTGGG - Intergenic
1159507452 18:69355785-69355807 GGAAATGCACAGATGGGCCTAGG - Intergenic
1159555510 18:69941134-69941156 GAAAATGTACAGAAACACCTGGG + Intronic
1161927292 19:7310738-7310760 AAAAATACACACATACAGCTGGG - Intergenic
1162302685 19:9852981-9853003 GAAAATGGAAAAATTCAGCTGGG + Intergenic
1163764813 19:19157550-19157572 CAAAACTCACTGATGCAGCTGGG + Intronic
1202638700 1_KI270706v1_random:63415-63437 AAAGATGCACAGGTACAGCTTGG - Intergenic
925299559 2:2800877-2800899 GAAAATGCACACATGCACCATGG - Intergenic
925435097 2:3830202-3830224 GAAACTGCAGAGATGCATTTAGG - Intronic
927398079 2:22678503-22678525 GAATATGCACTGATACAGCCAGG + Intergenic
928065809 2:28163470-28163492 GAAAATGTACACATGGTGCTGGG + Intronic
928816374 2:35299595-35299617 GAAAATGCTCACAAGCATCTTGG + Intergenic
929898394 2:45981123-45981145 GAAAATGCAACAATGAAGCTAGG + Intronic
930576828 2:53160830-53160852 GAAAATGCAAAGTTGCAGAAGGG - Intergenic
931904411 2:66826807-66826829 GATAATGCACAGAAACAGCATGG + Intergenic
932420096 2:71596545-71596567 TTAAATGCACAGATGCCTCTGGG + Intronic
932471174 2:71959856-71959878 AGAAATGCACAGATCCAGCAGGG - Intergenic
933168175 2:79097182-79097204 GAAAATGCCCAAATCCAGGTAGG - Intergenic
934491820 2:94766345-94766367 AAAGATGCACAGGTACAGCTTGG - Intergenic
934494159 2:94782933-94782955 AAAGATGCACAGGTACAGCTTGG - Intergenic
936505570 2:113102956-113102978 GACAAGGCACAGAAGGAGCTGGG + Intergenic
937003669 2:118491371-118491393 GAAAATGCAGAGGTACAGCATGG + Intergenic
937188280 2:120067277-120067299 GAGAATGGAGAGAAGCAGCTAGG + Intronic
939997134 2:148930444-148930466 GAAACTGCACAGAGGAAGTTTGG + Intronic
940004102 2:148995859-148995881 AAAAATGAATGGATGCAGCTGGG + Intronic
940446613 2:153785110-153785132 GAAACAGCAAAGATGGAGCTTGG - Intergenic
940449434 2:153818783-153818805 TAAAATGCTCAGATGGAGCAGGG - Intergenic
940734278 2:157431362-157431384 GAAATTGTACACATGCAGCAAGG + Intronic
941781427 2:169449825-169449847 GAAAATACAAATATTCAGCTGGG + Intergenic
942745520 2:179227780-179227802 GAAAATGAGCAGAGGCAGCAGGG + Intronic
943888653 2:193256516-193256538 GAAAATGCACAGATATTGTTAGG + Intergenic
944534474 2:200695761-200695783 GCAAAGGCACAGCTGCAGATGGG - Intergenic
944791954 2:203140003-203140025 GAAAATACACAAAAGCGGCTGGG + Intronic
945073407 2:206013689-206013711 TAAAATGAAAATATGCAGCTGGG + Intronic
945344651 2:208698877-208698899 AAACATGCACAGATGAAGCAAGG - Intronic
947184396 2:227442045-227442067 CAAAATTCACAGATACAGGTCGG - Intergenic
947328849 2:229007002-229007024 GAAAATTCACAAATGAAGCTTGG + Intronic
1169237344 20:3941777-3941799 GAAAATAAAAAGATGAAGCTGGG + Intronic
1170839994 20:19916903-19916925 TCAAATGCACAGATGGAGCCAGG - Intronic
1172057718 20:32165943-32165965 GACAAAGCACAGCTCCAGCTCGG + Exonic
1172664834 20:36591791-36591813 GAAACAGCACAGGGGCAGCTTGG - Exonic
1173550510 20:43930001-43930023 AAAAATACTCAGAAGCAGCTGGG - Intronic
1174449132 20:50609097-50609119 GAAAATGGACAGAGGGTGCTGGG + Intronic
1176843188 21:13856700-13856722 AAAGATGCACAGCTACAGCTTGG - Intergenic
1176845876 21:13876046-13876068 AAAGATGCACAGCTACAGCTTGG - Intergenic
1176848611 21:13895601-13895623 AAAGATGCACAGCTACAGCTTGG - Intergenic
1176849543 21:13902233-13902255 AAAGATGCACAGGTACAGCTTGG - Intergenic
1178477561 21:32950653-32950675 GAAAATGCACAAATGAAGAAGGG - Intergenic
1178702150 21:34842771-34842793 AAAAACATACAGATGCAGCTGGG + Intronic
1179305860 21:40153554-40153576 GTACAAGCACAGATGAAGCTAGG + Intronic
1181141632 22:20809769-20809791 GGAACTGCCCAGATGCAACTTGG + Intronic
1181927451 22:26371470-26371492 GAATATACACAAATGTAGCTGGG + Intronic
1182330000 22:29544979-29545001 GAAAATGGACTAATGCAGATGGG - Intronic
1182702504 22:32251932-32251954 GAAAATAGACAGATGTAGCTGGG + Intronic
1184061289 22:42083531-42083553 GAAAATGCACAGTTTCTGTTGGG - Exonic
1184348564 22:43927959-43927981 GAAGATGCATAGAGGAAGCTCGG - Intronic
1184808415 22:46811781-46811803 GAAAAGCCAAAAATGCAGCTGGG + Intronic
1184828839 22:46971298-46971320 CTGAGTGCACAGATGCAGCTGGG - Intronic
1184910833 22:47532885-47532907 GGAAGTGCACAGATGGGGCTAGG + Intergenic
1184938654 22:47743840-47743862 CAAAATGCACAGAGGCAATTTGG + Intergenic
1185057383 22:48588046-48588068 CATTATGCACAGATGGAGCTTGG - Intronic
949187190 3:1206334-1206356 GAAAATACACTGATGCATGTGGG - Intronic
951584446 3:24201144-24201166 GAAAATGAAGAGAAGCAGGTAGG + Intronic
952691731 3:36215006-36215028 GAAAAGGCACAGATACAGAAGGG - Intergenic
953267366 3:41404722-41404744 GCACATGCACATATGCAGCAGGG - Intronic
955025969 3:55167819-55167841 CAAACTGCAGAGCTGCAGCTGGG + Intergenic
956177202 3:66484171-66484193 GGAAATACACAGATGAAGCCTGG + Intronic
956322570 3:68014088-68014110 GAATGTACACAGATTCAGCTTGG - Intronic
956643716 3:71436303-71436325 GAAAATCCTAAGATGCAGCCTGG + Intronic
956811493 3:72867866-72867888 GCAAAGGCACGGATGAAGCTTGG + Intergenic
957278711 3:78122581-78122603 GAAAGTGCAGGAATGCAGCTGGG - Intergenic
957416250 3:79909297-79909319 AAAAAGACACAGATGTAGCTAGG + Intergenic
957560381 3:81813661-81813683 CAAAATGCAAAGATCCAGCTTGG + Intergenic
958979837 3:100708578-100708600 GAAGATGCACAGATGGTCCTAGG - Intergenic
960778933 3:121295579-121295601 GAAAATTCACACATACTGCTAGG - Intronic
961378217 3:126481160-126481182 TAAAATGGACAGATCCAGCGGGG - Intergenic
961794598 3:129400756-129400778 GAATAGCCACAGATGCAGCAGGG - Intergenic
962739527 3:138352877-138352899 GAGAAGTCACAGATGCAGCCTGG - Intronic
963688750 3:148471951-148471973 GAAAAGGCACTGATGCAACAGGG + Intergenic
966175081 3:177129847-177129869 AAAAATGCACATATCCAGCAGGG + Intronic
966193763 3:177294176-177294198 GGAAGAGCAGAGATGCAGCTGGG + Intergenic
967248177 3:187509768-187509790 CAATCTGCACTGATGCAGCTGGG - Intergenic
968004808 3:195235215-195235237 GAAAATACACAGTTAGAGCTGGG - Intronic
969310233 4:6348650-6348672 GAAAAGGCTGGGATGCAGCTTGG + Intronic
971707210 4:30060539-30060561 GAAAATGCACAGCGACAGCAGGG + Intergenic
972168716 4:36318907-36318929 GAAAATGCACAGAAGAGGCCAGG - Intronic
972463164 4:39325676-39325698 GAAGATTCACAGATGAGGCTGGG - Intronic
973367569 4:49219979-49220001 AAAGATGCACAGGTACAGCTTGG - Intergenic
973393484 4:49575453-49575475 AAAGATGCACAGGTACAGCTTGG + Intergenic
976332979 4:83852960-83852982 GAAAGTGCACAGATGGGCCTAGG - Intergenic
976437252 4:85032441-85032463 CAAAATGCACAAATGAAGCAAGG + Intergenic
977326262 4:95578670-95578692 TCAAATGCACAGATGCACATAGG - Intergenic
977993679 4:103476422-103476444 GGAAGTGCACAGATGAACCTAGG + Intergenic
978100708 4:104837482-104837504 GAAAATGCTCAGAAGAAGATGGG + Intergenic
978597648 4:110395674-110395696 GAAAGTTCAGAAATGCAGCTTGG - Intronic
981990997 4:150920975-150920997 GAAAATGCCCAGTCACAGCTTGG - Intronic
982974183 4:162032458-162032480 GAAAATGCACAGAAATAGTTTGG + Intronic
983265989 4:165508549-165508571 AGAAATGCAAAGATGCCGCTGGG + Intergenic
985140699 4:186837653-186837675 GAAAATGCACATATACACCATGG - Intergenic
1202766038 4_GL000008v2_random:149274-149296 AAAGATGCACAGGTACAGCTTGG - Intergenic
985724278 5:1507561-1507583 GGAAATGCAGAGATGAAGATGGG + Intronic
986292975 5:6415200-6415222 GAAGATGCAGAGATGCAGAGGGG - Intergenic
987363920 5:17131287-17131309 GAAAAAGCATAGTTGCTGCTAGG + Intronic
989177385 5:38541843-38541865 GAAAATGAACAAATACAGATGGG + Intronic
990047262 5:51448350-51448372 AAAAATGAACAGATGAACCTTGG - Intergenic
991597156 5:68317309-68317331 AAAAATGTGCAGATGCATCTTGG - Intergenic
992037814 5:72798301-72798323 GAAAAGGCAGAGATGCAGGGTGG + Intergenic
992919804 5:81503157-81503179 AAAAAACAACAGATGCAGCTGGG + Intronic
993234475 5:85286079-85286101 TAAAATGCACACATGCGGCTGGG + Intergenic
993622371 5:90183828-90183850 GAAAATGTAGAGATGTAGATTGG - Intergenic
993953365 5:94202098-94202120 GGAAGTGCACAGATGGACCTAGG + Intronic
996489264 5:124073474-124073496 TAAAACACACAGATGCAGCCTGG - Intergenic
996845731 5:127896739-127896761 GAAAATGAAAAGAATCAGCTGGG - Intergenic
998016390 5:138735499-138735521 GCAAAGGCACACAGGCAGCTGGG - Intronic
998419811 5:141973532-141973554 GAAAATGCACAGAGGCTGGCCGG - Intronic
998672910 5:144373953-144373975 GAAACTGCAGTGATGCAGCTAGG - Intronic
1000447682 5:161344302-161344324 GAAAATACAGAGATGGGGCTAGG + Intronic
1000699655 5:164433083-164433105 GAAAATGCCAGGATGCTGCTTGG + Intergenic
1000924378 5:167176003-167176025 GAAAGACCACAGATACAGCTGGG - Intergenic
1001330761 5:170760765-170760787 GAAAATGCACAGATGGACCTAGG - Intergenic
1001530642 5:172459123-172459145 GACAAGGCACAGTGGCAGCTGGG - Intergenic
1002130168 5:177076365-177076387 GGAAGTGCACAGATGGACCTAGG - Intronic
1003250601 6:4426473-4426495 GATAAGGCAGAGGTGCAGCTTGG - Intergenic
1004025610 6:11815341-11815363 GAAAATGCCAAGCTGGAGCTGGG + Intergenic
1004999461 6:21226036-21226058 GAGAATCCTCAGATGGAGCTGGG + Intronic
1005214960 6:23515145-23515167 GGAAGTGCACAGATGGACCTAGG - Intergenic
1005505481 6:26465625-26465647 GGAAATGCACAGCAGCAGCAAGG + Intronic
1006261343 6:32874151-32874173 GAAAATGTACATATGCACCATGG - Intergenic
1006370895 6:33643055-33643077 GAAAAGACAAAGATGGAGCTTGG + Intronic
1006421682 6:33938426-33938448 GAAAATGGACTAATCCAGCTGGG - Intergenic
1006453324 6:34117848-34117870 GGAAATACATAGATGCAGCCAGG + Intronic
1007020853 6:38519772-38519794 GAAATGGCAGGGATGCAGCTAGG - Intronic
1007247434 6:40472591-40472613 GGAAGTGCACAAATCCAGCTCGG - Intronic
1007976140 6:46103403-46103425 CAATCTGCACTGATGCAGCTAGG + Intergenic
1011146204 6:84220022-84220044 GATAATGCACAGAGGCAGGGAGG + Intronic
1017296861 6:152807587-152807609 GAATATGAAAAGATGCAGATGGG + Intergenic
1017501668 6:155031425-155031447 GAAAATGAAGAGATGAGGCTGGG + Intronic
1017620112 6:156287823-156287845 TAAAATGCACATATGGGGCTGGG + Intergenic
1018020248 6:159756147-159756169 GAAAATGCACAGATGTATGGTGG - Exonic
1020572455 7:9883150-9883172 GAAAATGCGGAGATGGAGATTGG + Intergenic
1021012038 7:15481753-15481775 GAAAATGCATAAATGCATCAGGG - Intronic
1022535963 7:31098680-31098702 CATTATGCACAGATGCAGCGGGG + Intronic
1022671422 7:32459803-32459825 GAATATCCAAAGATGCAGCTGGG + Intergenic
1023965156 7:44960293-44960315 GGAAATGGGCAGATGCTGCTGGG + Intergenic
1024298227 7:47863270-47863292 GAAACTGCACAGACCCAGCATGG - Intronic
1026371122 7:69700536-69700558 GAAAATCCCCAGAGGCAGCCAGG - Intronic
1026621032 7:71950106-71950128 CAAAATGCACAAATGAAGCAAGG - Intronic
1026982911 7:74537112-74537134 AAAAATACAAACATGCAGCTGGG + Intronic
1027544351 7:79507687-79507709 GGAAATGCACAGTTACACCTTGG + Intergenic
1031033008 7:116755087-116755109 GACAAAGAGCAGATGCAGCTTGG - Intronic
1031036027 7:116788838-116788860 GAAAATGCCCAAATGGAGTTTGG + Intronic
1031883885 7:127225518-127225540 GAGAATGATCTGATGCAGCTAGG + Intronic
1032221220 7:129995695-129995717 GAAAATGAACACATTCAGCCAGG + Intergenic
1032850550 7:135791546-135791568 GGAAATGCACAGATTCATCTAGG - Intergenic
1033813569 7:145046173-145046195 GAGAATGCACAGCTGGAGCATGG + Intergenic
1034164538 7:149015180-149015202 AAAACTGCAGAGATGCAGCCAGG - Intronic
1036289127 8:7471827-7471849 GAAAAGGAACAGATGCAACAGGG - Intronic
1036332348 8:7839700-7839722 GAAAAGGAACAGATGCAACAGGG + Intronic
1038072553 8:24033407-24033429 GAAAAAGCACAGAAGCCTCTGGG - Intergenic
1038304824 8:26389986-26390008 GAAAATGTACCCAAGCAGCTTGG - Intronic
1038410865 8:27358704-27358726 GAAAAGGCAAAGATGAAGCATGG - Intronic
1038991547 8:32873748-32873770 GCATTTGCACAGATGCAGCAGGG + Intergenic
1039734246 8:40313877-40313899 GAAAGTGCACAGATGGGCCTAGG - Intergenic
1039956268 8:42209355-42209377 GAAAATGCACATATACACCGAGG + Intergenic
1040547322 8:48408880-48408902 GAAGATGAGCAGATGCTGCTGGG + Intergenic
1041289760 8:56297570-56297592 GCAAATGCACAGAAGGAGCTTGG + Intergenic
1042784665 8:72535202-72535224 GGAAATGCAGAGCTGGAGCTTGG + Intergenic
1043043422 8:75291032-75291054 GAAAATACAAAGAGGCATCTTGG - Intergenic
1044436341 8:92168238-92168260 GAAATTGTACACATGCATCTAGG - Intergenic
1044614830 8:94129252-94129274 GAAAAGGCACAGAGGCAGAAGGG + Intronic
1045117447 8:98999011-98999033 GAAAATGCTCACAGGCACCTGGG + Intergenic
1045660503 8:104432626-104432648 GCAAATACATAGAAGCAGCTTGG + Intronic
1046707079 8:117466833-117466855 GAGAAAGCACAGAGGCAGTTGGG - Intergenic
1047991196 8:130288466-130288488 GTAAATGCACAGCTGCAGGTAGG - Intronic
1048171540 8:132111368-132111390 GACAATGCACTGATTCAGCATGG + Intergenic
1048698412 8:137055642-137055664 GAAAATGCACTGATGCCCATGGG + Intergenic
1049185834 8:141252640-141252662 GGAAATTCACAGACGCAGGTGGG - Intronic
1049185846 8:141252744-141252766 GGAAATTCACAGACGCAGGTGGG - Intronic
1050726122 9:8651218-8651240 GAAAATGCAGAGATCCATCGTGG - Intronic
1051708887 9:19909762-19909784 GAAAATCAACAGATGCAGGAAGG - Intergenic
1052381454 9:27775365-27775387 GAAAAAGCAAAGATGCTGTTTGG - Intergenic
1052877763 9:33580236-33580258 AAAGATGCACAGGTACAGCTTGG + Intergenic
1052878649 9:33586423-33586445 AAAGATGCACAGGTACAGCTTGG + Intergenic
1052879080 9:33589508-33589530 AAAGATGCACAGGTACAGCTTGG + Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053414432 9:37938141-37938163 GAGGCTGCACAGATGCAGGTAGG - Intronic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1053496896 9:38554711-38554733 AAAGATGCACAGGTACAGCTTGG - Intronic
1053498222 9:38563969-38563991 AAAGATGCACAGGTACAGCTTGG - Intronic
1053619210 9:39798816-39798838 AAGCATGCACACATGCAGCTGGG + Intergenic
1053664346 9:40307136-40307158 AAAGATGCACAGGTACAGCTTGG + Intronic
1053664870 9:40310391-40310413 AAAGATGCACAGGTACAGCTTGG + Intronic
1053666183 9:40319516-40319538 AAAGATGCACAGGTACAGCTTGG + Intronic
1053877368 9:42558165-42558187 AAGCATGCACACATGCAGCTGGG + Intergenic
1053895295 9:42736523-42736545 AAGCATGCACACATGCAGCTGGG - Intergenic
1053913418 9:42927604-42927626 AAAGATGCACAGGTACAGCTTGG + Intergenic
1053913914 9:42930833-42930855 AAAGATGCACAGGTACAGCTTGG + Intergenic
1053915327 9:42941466-42941488 AAAGATGCACAGGTACAGCTCGG + Intergenic
1053915767 9:42944563-42944585 AAAGATGCACAGTTACAGCTTGG + Intergenic
1054234327 9:62543557-62543579 AAGCATGCACACATGCAGCTGGG - Intergenic
1054264947 9:62908613-62908635 AAGCATGCACACATGCAGCTGGG - Intergenic
1054377336 9:64459544-64459566 AAAGATGCACAGGTACAGCTTGG + Intergenic
1054518426 9:66056767-66056789 AAAGATGCACAGGTACAGCTTGG - Intergenic
1054519744 9:66065893-66065915 AAAGATGCACAGGTACAGCTTGG - Intergenic
1054520268 9:66069149-66069171 AAAGATGCACAGGTACAGCTTGG - Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057161394 9:92890846-92890868 AAAGATGCACAGGTACAGCTTGG - Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1057676805 9:97142268-97142290 AAAGATGCACAGGTACAGCTTGG - Intergenic
1057677244 9:97145365-97145387 AAAGATGCACAGGTACAGCTTGG - Intergenic
1057677687 9:97148453-97148475 AAAGATGCACAGGTACAGCTTGG - Intergenic
1058745008 9:107981911-107981933 GAAAATGCATGGATGAGGCTGGG - Intergenic
1060154662 9:121310924-121310946 ACAAATGCATAGATGCAGGTGGG + Intronic
1060620443 9:125060835-125060857 GAAAATGGACTAATACAGCTAGG + Intronic
1061099664 9:128483186-128483208 AAAAATGCACAACTGCGGCTGGG - Intronic
1061105274 9:128525339-128525361 CAAGAGGCACAGATGCAGCAGGG + Exonic
1061166380 9:128924964-128924986 GTAAATACACAAATACAGCTAGG - Intronic
1061587190 9:131576739-131576761 GTAGTTGCACACATGCAGCTGGG + Intergenic
1062227814 9:135463457-135463479 GCCAATGCACAGCTGCTGCTGGG + Intergenic
1062631970 9:137467126-137467148 GAGAAGGCACAGATGCAGGTTGG - Intronic
1203546787 Un_KI270743v1:134163-134185 AAAGATGCACAGGTACAGCTTGG - Intergenic
1185841179 X:3392735-3392757 GAAAATGCACATATACACCATGG + Intergenic
1185961919 X:4553747-4553769 GAGAATGCTCAAATGCAGATTGG + Intergenic
1187109803 X:16285329-16285351 AAAAATCCACAGAGACAGCTCGG + Intergenic
1188656827 X:32707433-32707455 GCAAATGCACAGAAGCTGGTGGG + Intronic
1189211408 X:39287093-39287115 AAAAATGCACACATGTAACTTGG - Intergenic
1189911152 X:45811557-45811579 ATAAAGGCACAGATGTAGCTAGG - Intergenic
1190216195 X:48481098-48481120 GAAGATGCACAGAGCCAGATGGG + Intronic
1190279534 X:48920227-48920249 GAAGATGCACAGATGCTCCAGGG + Intergenic
1190379748 X:49828418-49828440 GGAAATGCACAGATGGGCCTAGG + Intergenic
1190710078 X:53061326-53061348 TTAACTGCACAGAAGCAGCTAGG - Intronic
1192160414 X:68782218-68782240 GAATCTGCACTGATGCAGCCAGG - Intergenic
1192161433 X:68791131-68791153 GAATCTGCACTGATGCAGCCAGG + Intergenic
1192419837 X:71019902-71019924 GAAAATGAACAGCCTCAGCTGGG - Intergenic
1192475775 X:71441173-71441195 GAAAATATACAGATGGGGCTTGG - Intronic
1192544636 X:72003461-72003483 CAAAATGCTCAGGTTCAGCTGGG + Intergenic
1192742552 X:73907268-73907290 GAAAATGCACATATACACCATGG - Intergenic
1194773908 X:97939275-97939297 GAAATTGCACAGATGGAGAGGGG - Intergenic
1194864209 X:99046191-99046213 AAAAATGGACAGATCCAGCAAGG - Intergenic
1195619497 X:106938856-106938878 GAAATTGCAAAGATGGAGATGGG + Intronic
1195758349 X:108221104-108221126 AAAAATGCAGAAATGCAGCCTGG + Intronic
1195981988 X:110588949-110588971 TAAAATGCACAGAAGCATCAAGG + Intergenic
1198091547 X:133335985-133336007 GAAGTTGCACAGAGACAGCTGGG - Intronic
1199673775 X:150167321-150167343 GCAATTGCACAGATGCATCATGG - Intergenic
1201355579 Y:13093918-13093940 GAAAATGCACAAATAAAGCAAGG + Intergenic