ID: 1056586778

View in Genome Browser
Species Human (GRCh38)
Location 9:87932409-87932431
Sequence TCAGTGGTGGCCTTATTAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056586778_1056586791 30 Left 1056586778 9:87932409-87932431 CCCACTAATAAGGCCACCACTGA No data
Right 1056586791 9:87932462-87932484 CTAGGTCACCAGGTCCCCATTGG No data
1056586778_1056586788 12 Left 1056586778 9:87932409-87932431 CCCACTAATAAGGCCACCACTGA No data
Right 1056586788 9:87932444-87932466 TGACTAGGCTTCCAATGACTAGG No data
1056586778_1056586783 -3 Left 1056586778 9:87932409-87932431 CCCACTAATAAGGCCACCACTGA No data
Right 1056586783 9:87932429-87932451 TGACCAGGTCCCCACTGACTAGG No data
1056586778_1056586789 20 Left 1056586778 9:87932409-87932431 CCCACTAATAAGGCCACCACTGA No data
Right 1056586789 9:87932452-87932474 CTTCCAATGACTAGGTCACCAGG 0: 15
1: 6
2: 3
3: 11
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056586778 Original CRISPR TCAGTGGTGGCCTTATTAGT GGG (reversed) Intergenic
No off target data available for this crispr