ID: 1056586781

View in Genome Browser
Species Human (GRCh38)
Location 9:87932422-87932444
Sequence AGTGGGGACCTGGTCAGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056586781_1056586788 -1 Left 1056586781 9:87932422-87932444 CCACCACTGACCAGGTCCCCACT No data
Right 1056586788 9:87932444-87932466 TGACTAGGCTTCCAATGACTAGG No data
1056586781_1056586791 17 Left 1056586781 9:87932422-87932444 CCACCACTGACCAGGTCCCCACT No data
Right 1056586791 9:87932462-87932484 CTAGGTCACCAGGTCCCCATTGG No data
1056586781_1056586792 22 Left 1056586781 9:87932422-87932444 CCACCACTGACCAGGTCCCCACT No data
Right 1056586792 9:87932467-87932489 TCACCAGGTCCCCATTGGTGAGG No data
1056586781_1056586789 7 Left 1056586781 9:87932422-87932444 CCACCACTGACCAGGTCCCCACT No data
Right 1056586789 9:87932452-87932474 CTTCCAATGACTAGGTCACCAGG 0: 15
1: 6
2: 3
3: 11
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056586781 Original CRISPR AGTGGGGACCTGGTCAGTGG TGG (reversed) Intergenic
No off target data available for this crispr