ID: 1056586791

View in Genome Browser
Species Human (GRCh38)
Location 9:87932462-87932484
Sequence CTAGGTCACCAGGTCCCCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056586779_1056586791 29 Left 1056586779 9:87932410-87932432 CCACTAATAAGGCCACCACTGAC No data
Right 1056586791 9:87932462-87932484 CTAGGTCACCAGGTCCCCATTGG No data
1056586782_1056586791 14 Left 1056586782 9:87932425-87932447 CCACTGACCAGGTCCCCACTGAC 0: 6
1: 25
2: 77
3: 157
4: 459
Right 1056586791 9:87932462-87932484 CTAGGTCACCAGGTCCCCATTGG No data
1056586787_1056586791 -1 Left 1056586787 9:87932440-87932462 CCACTGACTAGGCTTCCAATGAC 0: 5
1: 10
2: 6
3: 12
4: 117
Right 1056586791 9:87932462-87932484 CTAGGTCACCAGGTCCCCATTGG No data
1056586785_1056586791 1 Left 1056586785 9:87932438-87932460 CCCCACTGACTAGGCTTCCAATG 0: 5
1: 13
2: 3
3: 8
4: 144
Right 1056586791 9:87932462-87932484 CTAGGTCACCAGGTCCCCATTGG No data
1056586784_1056586791 7 Left 1056586784 9:87932432-87932454 CCAGGTCCCCACTGACTAGGCTT 0: 6
1: 0
2: 0
3: 48
4: 190
Right 1056586791 9:87932462-87932484 CTAGGTCACCAGGTCCCCATTGG No data
1056586781_1056586791 17 Left 1056586781 9:87932422-87932444 CCACCACTGACCAGGTCCCCACT No data
Right 1056586791 9:87932462-87932484 CTAGGTCACCAGGTCCCCATTGG No data
1056586786_1056586791 0 Left 1056586786 9:87932439-87932461 CCCACTGACTAGGCTTCCAATGA 0: 5
1: 12
2: 3
3: 7
4: 156
Right 1056586791 9:87932462-87932484 CTAGGTCACCAGGTCCCCATTGG No data
1056586778_1056586791 30 Left 1056586778 9:87932409-87932431 CCCACTAATAAGGCCACCACTGA No data
Right 1056586791 9:87932462-87932484 CTAGGTCACCAGGTCCCCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056586791 Original CRISPR CTAGGTCACCAGGTCCCCAT TGG Intergenic
No off target data available for this crispr