ID: 1056587691

View in Genome Browser
Species Human (GRCh38)
Location 9:87939032-87939054
Sequence GAGGATTAGGAGAAGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056587691_1056587704 29 Left 1056587691 9:87939032-87939054 CCCTCTTCCTTCTCCTAATCCTC No data
Right 1056587704 9:87939084-87939106 GCCGCCCTCCTACTGGTCTGTGG No data
1056587691_1056587702 22 Left 1056587691 9:87939032-87939054 CCCTCTTCCTTCTCCTAATCCTC No data
Right 1056587702 9:87939077-87939099 GCTGCCAGCCGCCCTCCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056587691 Original CRISPR GAGGATTAGGAGAAGGAAGA GGG (reversed) Intergenic
No off target data available for this crispr