ID: 1056590615

View in Genome Browser
Species Human (GRCh38)
Location 9:87963546-87963568
Sequence TGGTAGGACTGGAGGAAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056590615_1056590621 -9 Left 1056590615 9:87963546-87963568 CCCAGTTTCCTCCAGTCCTACCA No data
Right 1056590621 9:87963560-87963582 GTCCTACCACCTGGAGCAGGAGG No data
1056590615_1056590629 16 Left 1056590615 9:87963546-87963568 CCCAGTTTCCTCCAGTCCTACCA No data
Right 1056590629 9:87963585-87963607 CCAGCACCACGCTTGGCCTCAGG No data
1056590615_1056590632 30 Left 1056590615 9:87963546-87963568 CCCAGTTTCCTCCAGTCCTACCA No data
Right 1056590632 9:87963599-87963621 GGCCTCAGGGCTCTTTCTCATGG No data
1056590615_1056590630 17 Left 1056590615 9:87963546-87963568 CCCAGTTTCCTCCAGTCCTACCA No data
Right 1056590630 9:87963586-87963608 CAGCACCACGCTTGGCCTCAGGG No data
1056590615_1056590626 9 Left 1056590615 9:87963546-87963568 CCCAGTTTCCTCCAGTCCTACCA No data
Right 1056590626 9:87963578-87963600 GGAGGGCCCAGCACCACGCTTGG No data
1056590615_1056590622 -8 Left 1056590615 9:87963546-87963568 CCCAGTTTCCTCCAGTCCTACCA No data
Right 1056590622 9:87963561-87963583 TCCTACCACCTGGAGCAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056590615 Original CRISPR TGGTAGGACTGGAGGAAACT GGG (reversed) Intergenic
No off target data available for this crispr