ID: 1056590756

View in Genome Browser
Species Human (GRCh38)
Location 9:87964153-87964175
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056590749_1056590756 16 Left 1056590749 9:87964114-87964136 CCGGGGCTTCTGGGCAGCTTGCG No data
Right 1056590756 9:87964153-87964175 TGGCTCCTTCCAGAACATGCAGG No data
1056590748_1056590756 20 Left 1056590748 9:87964110-87964132 CCATCCGGGGCTTCTGGGCAGCT No data
Right 1056590756 9:87964153-87964175 TGGCTCCTTCCAGAACATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056590756 Original CRISPR TGGCTCCTTCCAGAACATGC AGG Intergenic
No off target data available for this crispr