ID: 1056591541

View in Genome Browser
Species Human (GRCh38)
Location 9:87969241-87969263
Sequence TCCCCAGGCATTGGATCTGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 762
Summary {0: 1, 1: 0, 2: 12, 3: 112, 4: 637}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056591541_1056591546 5 Left 1056591541 9:87969241-87969263 CCAGCAGATCCAATGCCTGGGGA 0: 1
1: 0
2: 12
3: 112
4: 637
Right 1056591546 9:87969269-87969291 GTCAGGCAGCACCTCCTCCAGGG 0: 1
1: 0
2: 4
3: 44
4: 298
1056591541_1056591547 6 Left 1056591541 9:87969241-87969263 CCAGCAGATCCAATGCCTGGGGA 0: 1
1: 0
2: 12
3: 112
4: 637
Right 1056591547 9:87969270-87969292 TCAGGCAGCACCTCCTCCAGGGG 0: 1
1: 0
2: 4
3: 31
4: 299
1056591541_1056591548 11 Left 1056591541 9:87969241-87969263 CCAGCAGATCCAATGCCTGGGGA 0: 1
1: 0
2: 12
3: 112
4: 637
Right 1056591548 9:87969275-87969297 CAGCACCTCCTCCAGGGGCATGG 0: 1
1: 1
2: 2
3: 49
4: 501
1056591541_1056591545 4 Left 1056591541 9:87969241-87969263 CCAGCAGATCCAATGCCTGGGGA 0: 1
1: 0
2: 12
3: 112
4: 637
Right 1056591545 9:87969268-87969290 CGTCAGGCAGCACCTCCTCCAGG 0: 1
1: 0
2: 7
3: 45
4: 325
1056591541_1056591553 29 Left 1056591541 9:87969241-87969263 CCAGCAGATCCAATGCCTGGGGA 0: 1
1: 0
2: 12
3: 112
4: 637
Right 1056591553 9:87969293-87969315 CATGGGCACCTGCTCCTTAAAGG 0: 1
1: 0
2: 0
3: 11
4: 124
1056591541_1056591549 12 Left 1056591541 9:87969241-87969263 CCAGCAGATCCAATGCCTGGGGA 0: 1
1: 0
2: 12
3: 112
4: 637
Right 1056591549 9:87969276-87969298 AGCACCTCCTCCAGGGGCATGGG 0: 1
1: 0
2: 1
3: 22
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056591541 Original CRISPR TCCCCAGGCATTGGATCTGC TGG (reversed) Exonic
900181188 1:1311740-1311762 TCCCCAGGGATGGGACCTGCAGG + Exonic
900634822 1:3657847-3657869 TCCCCAGGTAGAGGAGCTGCTGG - Intronic
900732094 1:4268795-4268817 TCCCAAGGCATTTGATGAGCTGG - Intergenic
900814463 1:4832880-4832902 TCACCAGACACTGAATCTGCTGG - Intergenic
902115155 1:14115134-14115156 TCACCAGGAAGTGAATCTGCAGG - Intergenic
902189545 1:14752512-14752534 TCACCAGACGTTGAATCTGCTGG - Intronic
902189717 1:14753864-14753886 TCACCAGACACTGAATCTGCTGG - Intronic
902698999 1:18158865-18158887 TGCCCAGGCATAGAATCTGGAGG + Intronic
902988606 1:20170907-20170929 GCCCCAGGCAGTGGCACTGCTGG - Intronic
903076889 1:20777238-20777260 ACCCCAGGCACTGGTTATGCAGG + Intronic
903794245 1:25916626-25916648 TCACCAGCCATCAGATCTGCTGG - Intergenic
905364155 1:37439692-37439714 TCCCCAGGGACTGAATCTGCTGG - Intergenic
905524412 1:38625425-38625447 TCCCCAGGGAGTGGATTTGGAGG - Intergenic
906702956 1:47872990-47873012 CCACCAGGCACTGAATCTGCCGG - Intronic
907361597 1:53920706-53920728 TCCCGAAGCATTGGGTTTGCAGG - Intronic
907628495 1:56055715-56055737 TCACCAGACACTGAATCTGCTGG + Intergenic
907860996 1:58352905-58352927 TCACCAGACATTGAATCTGCTGG + Intronic
908584823 1:65556195-65556217 TCACCAGAGATTGAATCTGCTGG + Intronic
910514737 1:88047240-88047262 TCACCAGACACTGAATCTGCTGG + Intergenic
910623297 1:89279482-89279504 TCACCAGACATCAGATCTGCTGG + Intergenic
910898065 1:92089581-92089603 TCACCAGGCACTGAATCTGCTGG - Intronic
910976451 1:92911351-92911373 TCACCAGACATTGAATCTGCAGG + Intronic
911041977 1:93598456-93598478 TCCCCAGGCCTAGGAACTGAGGG + Intronic
911716646 1:101141030-101141052 TCACCAGACACTGAATCTGCTGG - Intergenic
912351029 1:109013172-109013194 TCACCAGGCAATGAATCTGCTGG + Intronic
912527359 1:110293398-110293420 TCTCCCTTCATTGGATCTGCCGG + Intergenic
913054148 1:115141928-115141950 TCCCCAGGCATACTATGTGCTGG - Intergenic
913531857 1:119739213-119739235 TCCCCGGGCTTGGGCTCTGCAGG + Intronic
914980700 1:152412015-152412037 TCCCCAGGCAAGGCCTCTGCAGG + Intronic
915100744 1:153497730-153497752 TCACCAGACACTGAATCTGCTGG + Intergenic
915340930 1:155176237-155176259 TCCCCAGGCCTTGGAAGGGCTGG - Intronic
916659065 1:166904331-166904353 CCCCCTGCCAGTGGATCTGCAGG + Intergenic
917098387 1:171422541-171422563 TCCCCACCAAATGGATCTGCTGG + Intergenic
917851203 1:179065870-179065892 TCACCAGACACTGAATCTGCTGG - Intronic
918491599 1:185087264-185087286 TCACCAGACACTGCATCTGCTGG - Intronic
918630503 1:186711908-186711930 TCACCAGACAATGAATCTGCTGG - Intergenic
919440747 1:197630310-197630332 TTACCAGGCACTGAATCTGCTGG - Intronic
919461845 1:197885938-197885960 TCACCAGACACTGAATCTGCTGG - Intergenic
919462425 1:197893881-197893903 TCACCAGGCATTGAATCTGCTGG - Intergenic
920844391 1:209581771-209581793 TCATCAGGCATTGAATTTGCTGG - Intergenic
921107348 1:211995865-211995887 TCACCAGACACTGAATCTGCTGG + Intronic
921249756 1:213285909-213285931 TCACCAGACACTGAATCTGCTGG + Intergenic
921354453 1:214273391-214273413 TCACCAGACACTGAATCTGCTGG - Intergenic
921481017 1:215664829-215664851 TCACCAGACACTGAATCTGCAGG + Intronic
921753492 1:218824992-218825014 TCACCAGACACTGGATCTGCAGG + Intergenic
921801460 1:219407826-219407848 TCCCCAGAAACTGAATCTGCTGG - Intergenic
922352257 1:224744036-224744058 TCTCCAGGCCTCGGAGCTGCCGG + Intergenic
922409301 1:225355175-225355197 TCACCAGCCACTGAATCTGCTGG - Intronic
922413457 1:225397629-225397651 TCACCTGGAATTGGAGCTGCAGG + Intronic
922514173 1:226194628-226194650 TCACCAGACACTGAATCTGCTGG - Intergenic
922823621 1:228502024-228502046 TCACCAGCCACTGGATATGCTGG + Intergenic
922975487 1:229780199-229780221 TCACCAGACACTGAATCTGCAGG + Intergenic
923003126 1:230023968-230023990 TCACCAGACACTGAATCTGCTGG - Intergenic
923064477 1:230505330-230505352 ACCCCAAACAATGGATCTGCTGG - Intergenic
923344094 1:233034393-233034415 TCACCAGACACTAGATCTGCTGG + Intronic
923405579 1:233655745-233655767 TCACCAGACACTGAATCTGCTGG + Intronic
923411443 1:233713838-233713860 TCACCAGACACTGAATCTGCTGG + Intergenic
923500014 1:234556713-234556735 TCACCAGACATTGAATCTGCTGG + Intergenic
923757354 1:236804090-236804112 TCACCAGACACAGGATCTGCTGG - Intronic
924286431 1:242492749-242492771 TCCTCAGGCACTGGATCTATTGG - Intronic
1063253853 10:4304688-4304710 ACCCCAGATACTGGATCTGCAGG - Intergenic
1063970917 10:11380754-11380776 TCCCCAGTCCCTGGGTCTGCAGG - Intergenic
1064741572 10:18440065-18440087 TCCCCAGACACTGAATCTACCGG - Intronic
1066019513 10:31283942-31283964 TCCCCAGACAATGAATCTGCTGG + Intergenic
1067101662 10:43338807-43338829 CCCCCAGGATTTGGAACTGCTGG - Intergenic
1067515669 10:46940292-46940314 TCCCAATGCATAGGTTCTGCAGG + Intronic
1067646583 10:48111521-48111543 TCCCAATGCATAGGTTCTGCAGG - Intergenic
1067716996 10:48697524-48697546 TCACCAGGCATCTGATGTGCAGG + Intronic
1068412066 10:56669116-56669138 TCACCAGACATGGAATCTGCTGG - Intergenic
1068764651 10:60749656-60749678 TGCCCAGTAATGGGATCTGCTGG - Intergenic
1069258726 10:66366599-66366621 TCCCCAGACATTGAATCTGCTGG + Intronic
1069779324 10:70944858-70944880 TCCCCAGGTTGTGGATCTCCAGG - Intergenic
1070573383 10:77658615-77658637 TCACCAGACACTGAATCTGCTGG + Intergenic
1071279808 10:84090723-84090745 TCACCAGACGCTGGATCTGCTGG - Intergenic
1073080896 10:100860018-100860040 TCACCAGACATGGAATCTGCTGG - Intergenic
1073179565 10:101575484-101575506 TTCCCAGCCATTGGAACTGTAGG + Intronic
1073328909 10:102658346-102658368 CCCCCAGGCCTGGGATCTTCAGG + Exonic
1073470473 10:103719036-103719058 TCACCAGACACTGAATCTGCTGG + Intronic
1073737310 10:106364195-106364217 TCCCAAGGCACTGGAATTGCAGG - Intergenic
1073824913 10:107309466-107309488 TCACCAGACATTGAATCTGCAGG + Intergenic
1074252270 10:111762904-111762926 TCACCAGACACTGAATCTGCTGG + Intergenic
1074983258 10:118636365-118636387 TCCCCAGACACTGAATCTGCGGG - Intergenic
1075002291 10:118807753-118807775 TCACCAGACATGGAATCTGCCGG + Intergenic
1075163181 10:120042235-120042257 TGGCCAGACAGTGGATCTGCTGG - Intergenic
1075625257 10:123959561-123959583 TCCTCAGCCACTGAATCTGCTGG + Intergenic
1075920089 10:126204187-126204209 GCTCCAGTCAGTGGATCTGCTGG + Intronic
1076311931 10:129514759-129514781 TCACCAGGCACTGAATCTGCCGG + Intronic
1076540876 10:131213943-131213965 TCCACAGCCACTGGAACTGCCGG - Intronic
1077410672 11:2402526-2402548 TCCAGGGGCAGTGGATCTGCAGG + Intronic
1077646857 11:3932781-3932803 TCGCCAGACACTGAATCTGCTGG + Intronic
1078424128 11:11235507-11235529 TCACCAGGCACTGAACCTGCTGG + Intergenic
1078445341 11:11400597-11400619 TCACCAGACACTGGATCTGCTGG - Intronic
1078879010 11:15429486-15429508 TCACCAGACATTGAATCTGTTGG - Intergenic
1079306578 11:19328929-19328951 TCACCAGGCTCTGGCTCTGCGGG - Intergenic
1079686445 11:23364753-23364775 TCACCAGACATTGAATCTACTGG - Intergenic
1080081853 11:28229657-28229679 TCACCAGACACTGAATCTGCTGG + Intronic
1080191137 11:29550642-29550664 TCACCAGACACTGAATCTGCTGG - Intergenic
1080961570 11:37167276-37167298 TCACTAGGTATTGAATCTGCTGG - Intergenic
1081808011 11:45900538-45900560 TCCCCAGGCACTGGACCCGTGGG - Intronic
1084282693 11:68108932-68108954 TCCCCAGTAATTGGGTCTCCTGG - Intronic
1086170358 11:83829075-83829097 TCCCCAGGGAAGGGATCTGGAGG - Intronic
1086532830 11:87806313-87806335 TCACCAGACACTGAATCTGCTGG - Intergenic
1086860489 11:91919610-91919632 TCACCAGACACTGAATCTGCTGG - Intergenic
1087287238 11:96278104-96278126 TCCCCAGGCAGTGGTTCTCAAGG - Intronic
1087293425 11:96342972-96342994 TCCCCGGCCAGTGGATCTGAGGG + Exonic
1087583595 11:100090646-100090668 TCACCAGGCACTGAATCTCCTGG - Intronic
1087960873 11:104347571-104347593 TCACCAGACATTGAACCTGCTGG + Intergenic
1088326469 11:108606150-108606172 TCCCAAAGCACTGGAACTGCAGG + Intergenic
1088361017 11:108990098-108990120 TCCCCAGATACTGAATCTGCTGG + Intergenic
1088924728 11:114289919-114289941 TCACCAGACACTGAATCTGCTGG - Intronic
1089804978 11:121078575-121078597 GCCTTAGGCAGTGGATCTGCAGG + Intronic
1090302927 11:125662223-125662245 TCACCAGACACTGAATCTGCTGG - Intronic
1090363015 11:126186430-126186452 TCCCCAGGCTTCAGATGTGCAGG - Intergenic
1090474702 11:127009430-127009452 TCACCAGACAGTGGATCTGCAGG - Intergenic
1090651881 11:128814197-128814219 TCACCAGACACTGAATCTGCTGG - Intergenic
1090687156 11:129134875-129134897 TCACCAGACACTGAATCTGCTGG + Intronic
1091194661 11:133720582-133720604 GCCCCAGGCACAGGACCTGCAGG + Intergenic
1091313531 11:134594351-134594373 TCTCCAAACACTGGATCTGCTGG + Intergenic
1091809473 12:3383631-3383653 TCACCAGACACTGAATCTGCTGG + Intronic
1091924530 12:4334246-4334268 TCCACAGACACTGGATCTGCTGG - Intronic
1092353827 12:7778100-7778122 TCCCCAGACAGTGAATTTGCTGG + Intergenic
1092365855 12:7876391-7876413 TCCCCAGACAGTGAATTTGCTGG + Intronic
1093158990 12:15722688-15722710 TCACCAGACACTGAATCTGCTGG - Intronic
1093378059 12:18455626-18455648 TCACCAGACACTGAATCTGCTGG - Intronic
1093395142 12:18671864-18671886 TCACCAGACATTGAATCTGCAGG - Intergenic
1093967760 12:25345277-25345299 TCACCAGACACTGGATCTGCCGG + Intergenic
1094090528 12:26644407-26644429 TCACCAGACACTGAATCTGCTGG + Intronic
1095084743 12:38049115-38049137 TCCCCAGTCATTAGATCACCTGG + Intergenic
1095395138 12:41754232-41754254 TCACCAGGCACTGAATCTTCTGG + Intergenic
1095777883 12:46029356-46029378 TACCCAGGCATTGGTTCTCATGG + Intergenic
1095864607 12:46957728-46957750 TCACCAGACACTGAATCTGCTGG + Intergenic
1096883013 12:54687879-54687901 TCACCAGACACTGAATCTGCTGG + Intergenic
1097308901 12:58097488-58097510 TCACCAGACACTGAATCTGCTGG - Intergenic
1097523470 12:60699925-60699947 TCACCAGACACTGAATCTGCTGG - Intergenic
1097590904 12:61574009-61574031 TCCCCAGACAGTGAACCTGCTGG + Intergenic
1099120774 12:78686750-78686772 TCCCCAGGCACCAGATCTGCTGG - Intergenic
1099274939 12:80563230-80563252 TCACCAAGCACTGAATCTGCTGG - Intronic
1099659309 12:85534959-85534981 TCTCCAGACACTGGATCTGCTGG + Intergenic
1100206063 12:92351017-92351039 TCACCAGACACTGAATCTGCTGG + Intergenic
1100492006 12:95089663-95089685 TCCCCTAGGATTGGATCTCCTGG - Exonic
1100696661 12:97101297-97101319 TCACCAGACATTGAATCTACTGG - Intergenic
1101733106 12:107442921-107442943 TCACCAGACACTGAATCTGCTGG - Intronic
1101819502 12:108173051-108173073 TCCACAGACACTGGATCTGCTGG + Intronic
1101919924 12:108924191-108924213 TCCCCAGACACTGAATCTACTGG + Intronic
1102208668 12:111108226-111108248 TCTCCATGCATTGGATCAGGAGG + Intronic
1102346295 12:112163320-112163342 TCCCCAGCCCTGGGGTCTGCAGG + Intronic
1102375023 12:112415308-112415330 TCCCAAGGCCTTGGATTTACAGG - Intronic
1102407284 12:112684864-112684886 TTACCAGACATTGAATCTGCTGG - Intronic
1102734168 12:115143244-115143266 TCCCCAGACATGGAATGTGCTGG + Intergenic
1102936924 12:116905399-116905421 TCCCAAGGCATTGGGTTTACAGG + Intergenic
1102982260 12:117251190-117251212 TCACCAGACACTGAATCTGCTGG + Intronic
1103448343 12:121009651-121009673 TCCCCAGACACTGAATCTGCTGG + Intronic
1104503008 12:129303879-129303901 CCCTCAGGCATTGGAGCTCCTGG - Intronic
1105789792 13:23787288-23787310 TCATCAGACACTGGATCTGCTGG - Intronic
1105968122 13:25403230-25403252 TCACCAGACACTGAATCTGCAGG + Intronic
1106003546 13:25747628-25747650 TCCCCACGCATTGTATCCCCAGG - Intronic
1106109545 13:26764678-26764700 TCACCAGACACTGAATCTGCTGG - Intergenic
1106130255 13:26933764-26933786 TCCCCAGACACTGAGTCTGCTGG + Intergenic
1106478194 13:30115851-30115873 TCCCCAGACACTGAATCAGCTGG - Intergenic
1107256946 13:38439171-38439193 TCACCAGGCACAGAATCTGCTGG - Intergenic
1107673323 13:42769338-42769360 TCACCAGGAACTGAATCTGCTGG - Intergenic
1108568016 13:51720729-51720751 TCACCAGACACTGAATCTGCTGG - Intronic
1108679517 13:52767446-52767468 TCACCAGACATTGAATCTGCTGG + Intergenic
1110274962 13:73632840-73632862 TCACCAGACACCGGATCTGCTGG - Intergenic
1110351623 13:74515265-74515287 TCACCAGACACTGAATCTGCTGG + Intergenic
1110515032 13:76400604-76400626 TCACCAGACATTGAATCTTCTGG + Intergenic
1110827786 13:79992923-79992945 TCACCAGACATTGAATCTGTTGG - Intergenic
1110989068 13:82013584-82013606 TTACCAGACACTGGATCTGCTGG + Intergenic
1111219135 13:85181073-85181095 TCCCAAGGCCTTGGTTCTGCAGG - Intergenic
1112234874 13:97626237-97626259 ACCCCAAGCTTTGCATCTGCAGG - Intergenic
1112244391 13:97717395-97717417 TCCCCATGAACTGGAACTGCTGG + Intergenic
1112300201 13:98223057-98223079 TCCCCTGACATTGCTTCTGCAGG - Intronic
1112396714 13:99040220-99040242 TCACCAGGCACCAGATCTGCAGG + Intronic
1112555092 13:100459824-100459846 TCACCAGGAACTGAATCTGCTGG - Intronic
1112608048 13:100927362-100927384 TCCCCAGACAGGGAATCTGCTGG + Intergenic
1112764266 13:102724052-102724074 TCACCAGACACTGAATCTGCTGG + Intergenic
1114899028 14:27033063-27033085 TCACCAGACACTGAATCTGCAGG + Intergenic
1115197662 14:30818911-30818933 TCCCCAGACATCACATCTGCTGG + Intergenic
1115525134 14:34272356-34272378 TCACCAGACACTGGATTTGCTGG - Intronic
1116142100 14:41010564-41010586 TCACCAGACATTACATCTGCTGG - Intergenic
1116800359 14:49437181-49437203 TCACCAGACACTGAATCTGCTGG + Intergenic
1116809332 14:49524243-49524265 TCCCCAGACACTGAATCTCCTGG + Intergenic
1116862781 14:50007769-50007791 TCCCGCTGCACTGGATCTGCAGG + Intergenic
1117305207 14:54467308-54467330 TCACCAGTCACTGGATCTGCTGG + Intergenic
1117599693 14:57362555-57362577 TCCCCACCAAGTGGATCTGCTGG - Intergenic
1117901533 14:60538798-60538820 TCACCAGGAACTGAATCTGCTGG + Intergenic
1118348707 14:64958427-64958449 TCACCAGACACTGAATCTGCTGG + Intronic
1119863349 14:77953168-77953190 TCACCAGACAGTGAATCTGCTGG + Intergenic
1119894707 14:78210208-78210230 TCACCAGACACTGAATCTGCTGG - Intergenic
1120158987 14:81125685-81125707 TCCCCTGGCTTTGCATCTGCAGG - Intronic
1120398239 14:83995467-83995489 TCACCAGACACTGGATCTGCTGG + Intergenic
1120566709 14:86068695-86068717 TCACCAGACATTGAATCTGCTGG - Intergenic
1120596816 14:86450049-86450071 TCACCTGACATTGGACCTGCAGG + Intergenic
1120690314 14:87585405-87585427 TCAACAGGCACTGAATCTGCTGG - Intergenic
1121072913 14:91040944-91040966 GCCCCATTCACTGGATCTGCTGG - Intronic
1121236238 14:92393126-92393148 TCACCAGCCATCGAATCTGCTGG + Intronic
1121679299 14:95779328-95779350 TCCCCAGGCCTTGCATGTGGTGG - Intergenic
1121813811 14:96913961-96913983 TCACCAGGCACTGAATCTGCTGG + Intronic
1121835034 14:97084793-97084815 TCACCAGGAACTGGATCTGCTGG - Intergenic
1122260134 14:100513394-100513416 TCACCAGACACTGAATCTGCTGG + Intronic
1122285575 14:100650105-100650127 TCACCAGACACTGAATCTGCTGG + Intergenic
1122413326 14:101537041-101537063 TTCCCAGCTAATGGATCTGCTGG + Intergenic
1123670795 15:22654980-22655002 TCACCAGGGACTGAATCTGCCGG + Intergenic
1124047387 15:26162805-26162827 TCACCAGACACTGAATCTGCTGG - Intergenic
1124347676 15:28933392-28933414 TCACCAGGCACGGAATCTGCTGG + Intronic
1124626779 15:31312299-31312321 TCCCCAAGCCTTGTTTCTGCAGG + Intergenic
1125003024 15:34791280-34791302 TTCCCAGGTATGGAATCTGCTGG - Exonic
1126153407 15:45543297-45543319 TCACCAGACATGGAATCTGCTGG - Intergenic
1126183344 15:45807557-45807579 TCACCAGACACTGGATCTGCTGG - Intergenic
1126910963 15:53416402-53416424 TCACCAGACACTGAATCTGCAGG + Intergenic
1127057010 15:55142421-55142443 TCACCAGGCACTGAATTTGCTGG + Intergenic
1127733237 15:61819126-61819148 TCACCAGACACTGAATCTGCTGG + Intergenic
1128400946 15:67280449-67280471 TCACCAGACACCGGATCTGCCGG - Intronic
1129163540 15:73761620-73761642 TCACCAGACACTGAATCTGCTGG + Intergenic
1130031464 15:80318191-80318213 TCACCAGGCGTAGAATCTGCTGG - Intergenic
1130230532 15:82093426-82093448 TCACCAGACACTGAATCTGCTGG - Intergenic
1131473965 15:92720356-92720378 TCACCAGACATCAGATCTGCTGG + Intronic
1131744299 15:95429576-95429598 TGCCTTGGCAGTGGATCTGCGGG - Intergenic
1131787408 15:95927790-95927812 TCTCCAGGCACTGAACCTGCTGG - Intergenic
1133475563 16:6118405-6118427 TCACCAAACATTGAATCTGCTGG - Intronic
1134437022 16:14269008-14269030 TCACCAGACACTGAATCTGCTGG - Intergenic
1134503959 16:14790569-14790591 TCACCAGGCACTGAATCTGCAGG + Intronic
1134576613 16:15338339-15338361 TCACCAGGCACTGAATCTGCAGG - Intergenic
1134725826 16:16418160-16418182 TCACCAGGCACTGAATCTGCAGG + Intergenic
1134752637 16:16638253-16638275 TCCTCAGGCCTTGGATCTGTGGG - Intergenic
1134941607 16:18293699-18293721 TCACCAGGCACTGAATCTGCAGG - Intergenic
1134993424 16:18720823-18720845 TCCTCAGGCCTTGGATCTGTGGG + Intergenic
1135059876 16:19262370-19262392 TCACCAGACACTGAATCTGCTGG + Intronic
1135472655 16:22745294-22745316 TCACCAGACACTGGATCTGATGG + Intergenic
1135507972 16:23055499-23055521 TCCCCAGACACTGAATCTGCTGG + Intergenic
1135833553 16:25800883-25800905 TCACCAGACATTGAATTTGCTGG + Intronic
1135961869 16:27001659-27001681 TCACCAGACACTGGATCTCCTGG - Intergenic
1135994679 16:27238991-27239013 TCCCCAGGCACTGGGACTACAGG + Intronic
1136096568 16:27961344-27961366 TCCCAAGGCCTTGGAGCTCCTGG - Intronic
1137016726 16:35384385-35384407 TCCCCAGGTGTTGGTTCAGCAGG - Intergenic
1137292774 16:47063175-47063197 TCACCAGGTACTGAATCTGCTGG + Intergenic
1137815889 16:51397209-51397231 TTACCAGACATTGAATCTGCTGG - Intergenic
1137868763 16:51929392-51929414 TCCCCAGGCACTGCATCTCAAGG - Intergenic
1138402072 16:56754586-56754608 ACCCCATGCTTTGGCTCTGCAGG + Intronic
1139154745 16:64427131-64427153 TCACCAGACACTGAATCTGCTGG - Intergenic
1139243520 16:65418689-65418711 TCACCAGACATGGAATCTGCTGG - Intergenic
1139357951 16:66378614-66378636 TCCCCAGGCATTGGGTGCTCAGG - Intronic
1140032559 16:71350140-71350162 TCACCAGACACTGGATCTGCTGG - Intergenic
1141579532 16:84987808-84987830 TCACCAGGCATTGCGTCTTCGGG - Intronic
1141757729 16:86003525-86003547 TCCCCAGACACTGAACCTGCTGG + Intergenic
1142135169 16:88448648-88448670 TCCCCAGGCCTTGGCGCCGCCGG - Intergenic
1143321588 17:6071949-6071971 CTCCCAGGCATGGGATCTGAAGG + Intronic
1143466311 17:7139124-7139146 TCCCCAGACACTGGATCTGCCGG - Intergenic
1143632380 17:8146604-8146626 TGTCCAGGCAGTTGATCTGCTGG + Exonic
1143764708 17:9129957-9129979 CTCCCAGGCATTGGATCTGGAGG + Intronic
1144358575 17:14469668-14469690 TCACCAGGCACTGAATCTGCTGG - Intergenic
1145019842 17:19421105-19421127 TCACCAGACATCAGATCTGCAGG - Intergenic
1145102552 17:20088967-20088989 TCACCAGACACTGAATCTGCTGG + Intronic
1145939885 17:28737797-28737819 TCCCCATGCACTGTACCTGCAGG + Exonic
1146672591 17:34751922-34751944 TCCCCAGACACTGAATCTGCTGG - Intergenic
1148217889 17:45843693-45843715 GCCCCAGGTTTTGGCTCTGCAGG - Intergenic
1148502996 17:48106178-48106200 TCCTCAGCCCTTGGAGCTGCTGG - Intronic
1149357380 17:55855462-55855484 TCACCAGCCACTGAATCTGCTGG - Intergenic
1149589172 17:57815843-57815865 CCACCAGGCACTGCATCTGCTGG - Intergenic
1149888417 17:60364101-60364123 TCACCAGACACTGAATCTGCTGG - Intronic
1150129404 17:62659045-62659067 TCACCAGACATTGAATCGGCAGG - Intronic
1150345731 17:64403365-64403387 TCACCAGACACTGGAGCTGCTGG + Intronic
1150369007 17:64619630-64619652 TCACCAGACATTGACTCTGCTGG - Intronic
1150505476 17:65693945-65693967 TCCCCAGACCCTGAATCTGCTGG + Intronic
1150556489 17:66259392-66259414 TCACCAGACACTGAATCTGCAGG + Intergenic
1150600658 17:66648055-66648077 TCACCAGACACTGAATCTGCTGG - Intronic
1151406783 17:73892786-73892808 TCGCCAGACACTGAATCTGCTGG + Intergenic
1151437649 17:74107974-74107996 ACCCCAGGCACTGGAGCTGCTGG - Intergenic
1151526645 17:74674196-74674218 TCCCCAGTAACTGGAACTGCAGG + Intronic
1152239634 17:79154708-79154730 ACCTCAGGCCTTGGAGCTGCTGG + Intronic
1152332031 17:79678986-79679008 TCCCCAGGCTAAGGAGCTGCTGG - Intergenic
1153519838 18:5941228-5941250 TCAACAGGCACTGAATCTGCTGG + Intergenic
1155838985 18:30624847-30624869 TCACCAGACACTGAATCTGCAGG + Intergenic
1156110453 18:33719805-33719827 TCCCCAGACACTGAATCTGCTGG + Intronic
1156226332 18:35112898-35112920 TCACCAGACACTGAATCTGCTGG - Intronic
1156858407 18:41809742-41809764 TCCCCAGCTAATGGATCAGCAGG - Intergenic
1156931439 18:42649582-42649604 TCACCAGACACTGAATCTGCCGG - Intergenic
1157090053 18:44626407-44626429 TCATCAGACATGGGATCTGCTGG + Intergenic
1157512603 18:48288767-48288789 TCACCAGACATCGAATCTGCTGG + Intronic
1157546818 18:48552480-48552502 TCACCAGACACTGAATCTGCTGG - Intronic
1157689685 18:49671138-49671160 TCCCCAGACACTGAGTCTGCCGG + Intergenic
1158702837 18:59764371-59764393 TCCCCAGGAACCGAATCTGCTGG - Intergenic
1158708890 18:59819331-59819353 TCACCAGGGATTGAATCTGCTGG - Intergenic
1159156952 18:64596589-64596611 TCACCAGGAATTGAATCTACTGG - Intergenic
1159560428 18:69986981-69987003 TCACCAGACACTGAATCTGCTGG - Intergenic
1159564158 18:70029450-70029472 TCCTCTAGCATTGAATCTGCTGG - Intronic
1160137134 18:76282032-76282054 TCACCAGACATGGGCTCTGCTGG - Intergenic
1160307575 18:77754268-77754290 TGCACAGGCATGGGATCTCCTGG - Intergenic
1161808023 19:6456329-6456351 TCCCCAGGGCTTGGATGGGCTGG - Intronic
1162877949 19:13634827-13634849 TCACCAGACACTGAATCTGCTGG + Intergenic
1163168595 19:15515037-15515059 TGCCCAGGGCGTGGATCTGCTGG + Intronic
1163239744 19:16053522-16053544 TCACCAGACACTGAATCTGCTGG - Intergenic
1163296999 19:16418849-16418871 TCACCAGACACTGGATCTGCTGG + Intronic
1164637376 19:29801379-29801401 TCACCAGACATTGAATCTGCTGG - Intergenic
1165155113 19:33782176-33782198 TCCCCAGACACTGCATCTGCTGG - Intergenic
1166570819 19:43795993-43796015 TCACCAGCCATCGAATCTGCTGG - Exonic
1166608195 19:44164496-44164518 TCACCAGACACTGAATCTGCTGG - Intergenic
1167623752 19:50573267-50573289 TCTCCAGACACTGAATCTGCTGG + Intergenic
1168330330 19:55564273-55564295 TCCCCAGGCATCGGCTCTTTGGG - Intergenic
925456587 2:4021618-4021640 TCCCCAGACACCAGATCTGCTGG - Intergenic
926212799 2:10883574-10883596 ACCCCAGGCTTTGGCTCTACGGG + Intergenic
926449485 2:12984731-12984753 CCCACAAGCATTGGATATGCAGG - Intergenic
926840369 2:17073127-17073149 TCACCAGAAATTAGATCTGCTGG + Intergenic
926908535 2:17828411-17828433 TCCCCAGGCACTGAACCTGCTGG + Intergenic
928306053 2:30171300-30171322 TCACCAGACACTGAATCTGCTGG - Intergenic
928936440 2:36683863-36683885 TCACCAGGAACTGAATCTGCAGG - Intergenic
929584534 2:43105481-43105503 TCACCAGACACTGAATCTGCCGG + Intergenic
930122818 2:47773654-47773676 TAACCAGGCATTGGATCTAGGGG + Intronic
931010979 2:57913013-57913035 TCCTCAGACACTGAATCTGCTGG + Intronic
932781564 2:74561767-74561789 TCCCCAGGAGCTGGACCTGCTGG + Intronic
933157098 2:78988448-78988470 TCACCAGGCACTGGATCTGCCGG + Intergenic
933293806 2:80467850-80467872 TCACCAGACACTGAATCTGCTGG + Intronic
933320857 2:80773897-80773919 TCGCCATACACTGGATCTGCTGG + Intergenic
935190208 2:100771581-100771603 TCCTCAGGCTTTGGTTCTCCTGG + Intergenic
935636740 2:105254925-105254947 TCTCCAGGAACTGAATCTGCTGG + Intergenic
935788510 2:106570342-106570364 TCCCCAGGCGTGGAATCTGCTGG + Intergenic
935920294 2:108005665-108005687 TCACCAGGCAGTGAATCTGCCGG - Intronic
936885980 2:117310386-117310408 TCCCTAGGGATTTGAGCTGCAGG - Intergenic
937361137 2:121230999-121231021 AACCCAGGGATTGGAGCTGCAGG - Intronic
937635412 2:124150565-124150587 TCACTAGACATTGAATCTGCTGG - Intronic
938225389 2:129611500-129611522 TCCCCAAGCATGGGAACTGGTGG + Intergenic
938318727 2:130347724-130347746 TCACCAGACACTGAATCTGCTGG + Intronic
938412456 2:131076151-131076173 TCTCCAGACAGTGAATCTGCAGG + Intronic
938598474 2:132812812-132812834 TCCGCAGACACTGGATCTGCTGG - Intronic
938767218 2:134468352-134468374 CCACCAGGCACTGAATCTGCTGG + Intronic
939172928 2:138716455-138716477 TCACCATACATTGAATCTGCTGG + Intronic
939350687 2:141033760-141033782 TCACCAGACACTGAATCTGCTGG + Intronic
939566953 2:143796376-143796398 TCACCAGCCACTGAATCTGCTGG + Intergenic
940115384 2:150202909-150202931 TCACCAGACACTGAATCTGCTGG + Intergenic
940214702 2:151292427-151292449 TCACCAGACACTAGATCTGCAGG + Intergenic
940899136 2:159110377-159110399 TCCTCAGACACTGGTTCTGCTGG + Intronic
941097945 2:161262225-161262247 TCGCCAGACATTGAATCTGTTGG - Intergenic
941594977 2:167465435-167465457 TTCCCAGACACTGAATCTGCTGG - Intergenic
941688842 2:168477061-168477083 TCACCAGACACTGCATCTGCTGG - Intronic
942014595 2:171799124-171799146 TCACCAGACACTGAATCTGCTGG + Intronic
942187195 2:173435139-173435161 ACCCCAGGGACTGGAACTGCAGG - Intergenic
943313869 2:186361138-186361160 TCACCAGACACTGAATCTGCAGG + Intergenic
943781521 2:191829358-191829380 TCACCAGACACTGAATCTGCTGG + Intergenic
943834027 2:192496140-192496162 TCACCAGGCACTGAATCTGCTGG + Intergenic
944307086 2:198190945-198190967 TCACCAAACACTGGATCTGCTGG + Intronic
945763384 2:213943056-213943078 TCACCAGGCACTGGATCTTCTGG + Intronic
946344081 2:219094203-219094225 TCCCCAGGCACTGGATGTTAGGG - Intronic
946638805 2:221760651-221760673 TCACCAGACATTGAATCTGCTGG - Intergenic
946866748 2:224047717-224047739 TCACCAGGCACTGGATCTGCTGG + Intergenic
947352396 2:229259924-229259946 TCCCCAGACACTGAATCTGCTGG + Intronic
948067524 2:235092266-235092288 TGCCCAGCCAGTGGGTCTGCTGG + Intergenic
948146725 2:235713817-235713839 TCCTCAGGCATCAAATCTGCAGG - Intronic
948215951 2:236231532-236231554 TCACCAGACAATGAATCTGCTGG + Intronic
948223835 2:236293532-236293554 TCCCAAGGCCTTAGCTCTGCGGG - Intergenic
948398275 2:237663504-237663526 TCCCCAGACACTGAATCTGCTGG + Intronic
1169104071 20:2979363-2979385 TGCACAGGTATTGGATCTCCTGG + Intronic
1169833322 20:9849942-9849964 TCACCAGACACTGAATCTGCTGG + Intergenic
1169837925 20:9901098-9901120 TCACCAGACATGAGATCTGCTGG - Intergenic
1169890207 20:10444348-10444370 TCACCAGACAGTGAATCTGCTGG - Intronic
1170005181 20:11660631-11660653 TCCCCAAGCATGGGATTGGCAGG + Intergenic
1170029903 20:11933744-11933766 TCACCAGACATTGAATCTGCTGG - Intergenic
1170561974 20:17566559-17566581 TCACCAGACACTGAATCTGCTGG - Intronic
1170576382 20:17664831-17664853 TGCCCAGGAAATGGATCTGGGGG - Intronic
1171728247 20:28647867-28647889 TCACCAGACACTGGCTCTGCTGG + Intergenic
1171751008 20:29048726-29048748 TCACCAGACACTGGCTCTGCTGG + Intergenic
1171791964 20:29535210-29535232 TCACCAGACACTGGCTCTGCTGG - Intergenic
1171856379 20:30347674-30347696 TCACCAGACACTGGCTCTGCTGG + Intergenic
1172308163 20:33896565-33896587 TCACCAGACACTGAATCTGCTGG + Intergenic
1172958353 20:38778510-38778532 TCCCCGGGCAGGGGATCGGCTGG - Intergenic
1173334879 20:42104409-42104431 TCCCCAGACACTGGATTTACTGG + Intronic
1173381272 20:42544993-42545015 TGCCCAGGCCTTGGATCTAAAGG - Intronic
1173463566 20:43263173-43263195 ACCCCAGGCATTGGGGCTTCCGG - Intergenic
1173785719 20:45791717-45791739 TCCCCAGGCCTTGGCCCAGCGGG + Intronic
1174212091 20:48887824-48887846 TCCCCAGGAACTGGAACTACAGG - Intergenic
1174238557 20:49114566-49114588 TGCCCAGGGTGTGGATCTGCTGG + Exonic
1176238592 20:64065569-64065591 GCCCCAGGCGGTGGAGCTGCAGG + Intronic
1176313763 21:5222203-5222225 TCACCAGACACTGGCTCTGCTGG - Intergenic
1176937264 21:14881921-14881943 TCCCTAGACATGGAATCTGCTGG - Intergenic
1177141815 21:17365852-17365874 TCACCAGACACTGAATCTGCTGG + Intergenic
1177167161 21:17615240-17615262 TCACCAGACACTGGATCTGCTGG + Intergenic
1177719908 21:24892349-24892371 TCACCAGACACTGGATCTGGTGG - Intergenic
1177734933 21:25077125-25077147 TCACCAGACACTGAATCTGCTGG - Intergenic
1178071413 21:28972212-28972234 TCACCAGACACTGAATCTGCTGG + Intronic
1178252398 21:31016797-31016819 TCACCAGGCATGGAATCTGCTGG - Intergenic
1178352771 21:31884700-31884722 TCATCAGACACTGGATCTGCAGG + Intronic
1178495212 21:33080545-33080567 TCCACAGACATTGCCTCTGCTGG + Intergenic
1178519945 21:33281026-33281048 TCACCAGACACTGAATCTGCTGG - Intronic
1179149827 21:38800254-38800276 TCACCAGACACTGAATCTGCTGG + Intergenic
1179267290 21:39814959-39814981 TCACCAGGAATGGGATTTGCTGG + Intergenic
1180391582 22:12288312-12288334 TCACCAGACACTGGCTCTGCTGG - Intergenic
1180408163 22:12576442-12576464 TCACCAGACACTGGCTCTGCTGG + Intergenic
1180701003 22:17781428-17781450 TCCCCAGGAACTGGGGCTGCAGG + Intergenic
1182860971 22:33559140-33559162 TCACCATGCATCTGATCTGCCGG - Intronic
1183017794 22:35004186-35004208 TCACCAGACAGTGAATCTGCTGG - Intergenic
1183337996 22:37261707-37261729 TCACCGGACATTGAATCTGCTGG + Intergenic
1183888661 22:40906852-40906874 TCACCAGACACTGAATCTGCTGG - Intronic
1184528427 22:45039412-45039434 TCACCAGACACTGAATCTGCTGG - Intergenic
1184594122 22:45503709-45503731 GCCCAAGGCAGTGGTTCTGCCGG + Intronic
1184801246 22:46761745-46761767 TCCCCAGTAGTTGGAACTGCAGG - Intergenic
1185395800 22:50587263-50587285 TCCACAGCCTTAGGATCTGCTGG + Intronic
949681701 3:6521213-6521235 TCACCAGGCACTGAATTTGCTGG - Intergenic
949714714 3:6916546-6916568 TCACCAGACACTGAATCTGCTGG - Intronic
949823460 3:8139756-8139778 TCCCCACCAAATGGATCTGCTGG - Intergenic
950220697 3:11193501-11193523 TCACCAGTCATTGAATCTGCTGG - Intronic
950327914 3:12130017-12130039 TCACCAGGAACTGAATCTGCTGG + Intronic
950704443 3:14771215-14771237 TCACCAGGCACTGAATCTGCAGG + Intronic
950842422 3:15980198-15980220 TCACCAGTCACTGAATCTGCTGG - Intergenic
951411128 3:22368580-22368602 ACCGCAGTCATTGAATCTGCTGG - Intronic
951577832 3:24131756-24131778 TCACCAGACAGTGAATCTGCTGG + Intronic
951627901 3:24686670-24686692 TCCCAAGGCATTGCAGCTCCTGG + Intergenic
952234035 3:31460745-31460767 TCACCAGTCACTGAATCTGCAGG - Intergenic
952699478 3:36310695-36310717 TCCCCAGACACTGAATCTGCTGG + Intergenic
952726483 3:36591879-36591901 TTCCGAGACACTGGATCTGCTGG - Intergenic
952789151 3:37185313-37185335 TCACCAGACACTGAATCTGCTGG + Intergenic
952851861 3:37735979-37736001 TCGCCAGGAACTGAATCTGCCGG - Intronic
953756138 3:45647461-45647483 TGGCCAGGCATTGGATTTGCCGG - Intronic
953960911 3:47264973-47264995 TCGCTAGGCATTGAATCTGCTGG + Intronic
954284125 3:49606777-49606799 TCCCCAGACATTCCTTCTGCTGG + Intronic
954394455 3:50286098-50286120 ATGCCAGGCATTGGGTCTGCAGG + Intronic
954525940 3:51271357-51271379 TCACCAGACATTGAATCTACTGG - Intronic
955318477 3:57958116-57958138 TCACCAGACATAGAATCTGCTGG + Intergenic
955417111 3:58702816-58702838 TCACCAGACACTGAATCTGCTGG - Intergenic
956106969 3:65829513-65829535 TCCCCAGACATCATATCTGCTGG + Intronic
957219267 3:77361560-77361582 TCACCAGACACTGAATCTGCTGG - Intronic
957310298 3:78510278-78510300 TCACCAGACATTGAATCTACTGG - Intergenic
957464276 3:80566149-80566171 TCCCTAGACACTGGATCTGCTGG + Intergenic
957553706 3:81738963-81738985 TCACCAGGCATGGAACCTGCTGG - Intronic
957688316 3:83533764-83533786 TCAACAGGCACTGAATCTGCTGG + Intergenic
958180086 3:90048933-90048955 TCACCAGACACTGAATCTGCTGG - Intergenic
958875855 3:99616282-99616304 TACCCAGTAATTGGATTTGCTGG + Intergenic
959018069 3:101158470-101158492 TCACCAGGCACTGAATCTGCTGG + Intergenic
959019507 3:101173128-101173150 TCACCAGACACTGAATCTGCTGG - Intergenic
959141713 3:102493785-102493807 TCACCAGACACTGAATCTGCAGG + Intergenic
959416810 3:106086098-106086120 TCCCCAGTCACTGAATCTGCTGG - Intergenic
960031988 3:113063371-113063393 TCCCCAGACACTGGACCTGCTGG - Intergenic
960392083 3:117089993-117090015 TCACCAGACATTGAATCTTCTGG - Intronic
960584909 3:119311701-119311723 TTATCAGGCATTGGATCAGCTGG + Intronic
960635086 3:119777059-119777081 TCACCAGTCACTGAATCTGCTGG - Intergenic
961009862 3:123428516-123428538 TCACCAGGCATAGGCTCAGCAGG + Intronic
961101158 3:124200384-124200406 TCGCCAGACACTGAATCTGCAGG - Intronic
961818567 3:129563757-129563779 CCTCCAGGCAGTGGCTCTGCTGG + Intronic
962128480 3:132647852-132647874 TCACCAGACACTGAATCTGCTGG - Intronic
963146470 3:142000289-142000311 TCACCAGGCACTGAATCTGCCGG - Intronic
963390770 3:144661008-144661030 TCACCAGACATTGAACCTGCTGG - Intergenic
963734729 3:149007065-149007087 TCTCCAGCCACTGAATCTGCTGG - Intronic
964359281 3:155877720-155877742 TCACCAGGCACTGAATCTGCAGG - Intronic
965768688 3:172158065-172158087 TCACCAGGCATTGAATCTGCTGG + Intronic
966170624 3:177076058-177076080 TCACTAGGCACTGTATCTGCTGG - Intronic
966493540 3:180555128-180555150 TCACCAGACACTGAATCTGCTGG - Intergenic
966792817 3:183689456-183689478 TCACCAGACACTGAATCTGCTGG - Intergenic
967013936 3:185464814-185464836 TCACCAGACACTGAATCTGCTGG - Intronic
967719615 3:192801666-192801688 TCACCAGACAATGAATCTGCAGG + Intronic
967785217 3:193485839-193485861 TCACCAGACACTGAATCTGCTGG + Intronic
967813017 3:193776071-193776093 TCCCCAGGCCTGGGCTCTGGCGG - Intergenic
968804510 4:2763651-2763673 TCCCGGGGCACTGGAGCTGCGGG - Intergenic
969197209 4:5572554-5572576 TCACCAGACACTGCATCTGCAGG + Intronic
969283482 4:6187630-6187652 TCACCAGACACTGAATCTGCCGG + Intronic
969355853 4:6625199-6625221 TCCCCAGACACCGAATCTGCTGG - Intergenic
969950409 4:10829801-10829823 TCATCAGACATTGAATCTGCTGG + Intergenic
969951950 4:10846155-10846177 TCACCAGACACTGAATCTGCTGG + Intergenic
969965244 4:10987235-10987257 TCACCAGACACTGAATCTGCTGG + Intergenic
969983422 4:11181969-11181991 TCCCCATCCAATGGACCTGCTGG - Intergenic
970112953 4:12659372-12659394 TCCACAGGCATTGAATCTGCTGG - Intergenic
970136486 4:12930490-12930512 TCACCAGGCATTTAATCTGCTGG - Intergenic
970375002 4:15448090-15448112 TCGCCAGGCATCAAATCTGCTGG + Intergenic
970413739 4:15836220-15836242 TCACCAGACATTGAATCTGCTGG - Intronic
970478100 4:16444843-16444865 TCACCAGACACTGAATCTGCTGG + Intergenic
970579110 4:17458098-17458120 TCACCAGACATTGAGTCTGCTGG + Intergenic
970871698 4:20823643-20823665 TTACCAGACATAGGATCTGCTGG + Intronic
970968817 4:21957836-21957858 TCACCAGACACTGGATCTGCTGG + Intergenic
971098115 4:23431447-23431469 TCACCAGGCATTAAATCTCCTGG - Intergenic
971459691 4:26881553-26881575 TCACCAGACACTGAATCTGCTGG + Intronic
971493048 4:27234625-27234647 TCTGCAGGCATTGTTTCTGCAGG - Intergenic
971636427 4:29065133-29065155 TCACCAGGCATTGAATCTGCTGG + Intergenic
971660404 4:29407247-29407269 TCTCCAGGCCTTGAAACTGCTGG + Intergenic
971763905 4:30804650-30804672 TCACTAGACATTGAATCTGCTGG + Intronic
971993206 4:33928628-33928650 TCACCAGACACTGAATCTGCTGG + Intergenic
972009147 4:34153558-34153580 TCTCCAGACATTGAATCTGCTGG - Intergenic
972684922 4:41342900-41342922 TCACTAGACATTGAATCTGCTGG + Intergenic
972732993 4:41813634-41813656 TCACCAGACACTGAATCTGCTGG - Intergenic
972969248 4:44551988-44552010 TCACCAGGCATTAAATCTGCTGG - Intergenic
973596647 4:52498212-52498234 TCCCCAGACATTGAAAGTGCCGG + Intergenic
973604918 4:52577030-52577052 TCACCAGACATGGAATCTGCTGG + Intergenic
974441871 4:61929270-61929292 TCACCAGACAATGAATCTGCAGG + Intronic
974719508 4:65719408-65719430 TCACCAGACATCGCATCTGCTGG - Intergenic
975975942 4:80097053-80097075 TCACCAGGCACTGAATCTGCTGG - Intronic
976166674 4:82263621-82263643 TTGCCAGACACTGGATCTGCTGG - Intergenic
976285018 4:83362935-83362957 TCACCAGACATTGACTCTGCCGG + Intergenic
976426014 4:84904156-84904178 TCACCAGACACTGAATCTGCTGG + Intronic
976839785 4:89418725-89418747 TCGCCAGCCACTGAATCTGCTGG - Intergenic
977392905 4:96435403-96435425 TCACCAGACACTGAATCTGCTGG + Intergenic
977976317 4:103270852-103270874 TCACCAGACATTGAATATGCTGG - Intergenic
979069565 4:116184979-116185001 TCACCAGACATTGAATCTGCTGG + Intergenic
979366512 4:119830865-119830887 TTGCCAGACATTGAATCTGCTGG + Intergenic
980380172 4:132003601-132003623 TCACCAGACACTGAATCTGCTGG - Intergenic
980881896 4:138718974-138718996 TCCACAGACATGGGATCTGTCGG - Intergenic
981150179 4:141371426-141371448 GCCCTCGGCATTGGATCTCCTGG + Intergenic
981275000 4:142888798-142888820 TCACCAGACACTGAATCTGCCGG + Intergenic
981314672 4:143330515-143330537 TCACCAAACACTGGATCTGCTGG + Intergenic
981586763 4:146311730-146311752 TCCCCAGGGCTGGGCTCTGCGGG - Intronic
982099618 4:151955153-151955175 TCACCAGACAGTGAATCTGCTGG + Intergenic
982125224 4:152178313-152178335 TCACCAGGAATTGAATCTGCTGG + Intergenic
982419793 4:155181687-155181709 TCACCAGACACTGAATCTGCTGG + Intergenic
982508325 4:156248954-156248976 TCACCAGACACTGAATCTGCTGG - Intergenic
982605093 4:157505802-157505824 TCACTAGACATTGGATATGCTGG - Intergenic
982951201 4:161698204-161698226 TCACCAGACACTGAATCTGCTGG + Intronic
983849673 4:172565020-172565042 TCTCCAGACACTGAATCTGCTGG - Intronic
983954327 4:173679417-173679439 CCCTCAGACATTGGAACTGCTGG - Intergenic
983984759 4:174045122-174045144 TCACCAGACACTGAATCTGCTGG - Intergenic
984094986 4:175423803-175423825 TTCCCAGCCATTAGATCAGCAGG + Intergenic
984432011 4:179661887-179661909 TCCCCAGACATGGAACCTGCTGG + Intergenic
985433374 4:189903149-189903171 TCACCAGACACTGGCTCTGCTGG + Intergenic
985487085 5:158024-158046 GCCCCAGGGATTGGACCAGCTGG - Intronic
986104063 5:4643203-4643225 TCACCAGACACTAGATCTGCTGG - Intergenic
986143900 5:5058482-5058504 TCACCAGACAATGAATCTGCTGG + Intergenic
986609495 5:9552498-9552520 TCACCAGACATTGAACCTGCTGG - Intergenic
986674538 5:10171455-10171477 TCACCAGACACTGAATCTGCTGG + Intergenic
987732932 5:21800581-21800603 TCACCAGACGCTGGATCTGCTGG + Intronic
987872001 5:23631490-23631512 TCACCGGACACTGGATCTGCTGG - Intergenic
987968479 5:24909188-24909210 TTACCAGGCATTGCTTCTGCCGG - Intergenic
988410637 5:30881323-30881345 TCCTCAGGCATTGCAGCTCCTGG - Intergenic
989517908 5:42364632-42364654 TCACCAGACACTGGATCTGCTGG + Intergenic
989999242 5:50873748-50873770 TCACTAGGCACTTGATCTGCTGG - Intergenic
990349344 5:54900058-54900080 TCACCAGACACTGGATGTGCAGG + Intergenic
990377211 5:55183511-55183533 TCACCAGACACTGAATCTGCTGG - Intergenic
990434360 5:55773115-55773137 TCACCAGACACTGAATCTGCTGG - Intronic
990634921 5:57713956-57713978 TCACCAGACAGTGCATCTGCTGG + Intergenic
990874973 5:60474236-60474258 TCACCAGACATTTAATCTGCTGG - Intronic
991435774 5:66596287-66596309 TGCCCTGCCATTGGCTCTGCGGG + Intergenic
991948318 5:71923115-71923137 TCGCCAGACACTGGATCTGCTGG + Intergenic
992154657 5:73943116-73943138 TCACCAGACATGGAATCTGCTGG + Intergenic
992181868 5:74205363-74205385 TCACCAGACACTGTATCTGCTGG + Intergenic
993664946 5:90684599-90684621 TCACCAGGCACTGAATCTGCTGG - Intronic
994047722 5:95328417-95328439 TCACCAGGCACTGAACCTGCTGG + Intergenic
994716461 5:103327675-103327697 TCACCAGACACTGGATCTGCTGG + Intergenic
996439859 5:123477943-123477965 TCGCCAGACATTGAATCTGCTGG + Intergenic
996471931 5:123871329-123871351 TCCCAAGGCACTGGAGCTGGTGG + Intergenic
997232966 5:132257416-132257438 TGCTCGGGCCTTGGATCTGCAGG - Intronic
997877282 5:137560632-137560654 TCACCAGGCACCGAATCTGCTGG - Intronic
998291482 5:140918827-140918849 TCCCCAGACACTAAATCTGCTGG + Intronic
999734954 5:154506137-154506159 TCCCCAGGAACAGGGTCTGCAGG + Intergenic
999831455 5:155324090-155324112 TCACCAGACACTGAATCTGCTGG + Intergenic
1000261272 5:159590977-159590999 TCCCCAAGCACTGAATGTGCTGG - Intergenic
1000609048 5:163355489-163355511 TCACCAGACACTGAATCTGCTGG + Intergenic
1000767470 5:165309947-165309969 TCCCCAGCCAGTGTATCTGGAGG + Intergenic
1001021756 5:168189008-168189030 TCACCAGACACTGAATCTGCTGG - Intronic
1001188947 5:169608513-169608535 TCAGCAGGTACTGGATCTGCTGG - Intergenic
1001289018 5:170443323-170443345 TCCCCATGCATTGGAACTGTGGG - Intronic
1001446860 5:171792058-171792080 TCACCAGACACTGAATCTGCTGG + Intronic
1001458338 5:171885415-171885437 TACCCAGGCACTGGTTCTCCCGG + Intronic
1001485877 5:172119295-172119317 TCAGCAGGCCTTGGCTCTGCAGG + Intronic
1001527237 5:172437552-172437574 TCCCAAGGCCTTGGGTCTCCTGG + Intronic
1001553208 5:172619156-172619178 TCCCCAGACACGGAATCTGCTGG - Intergenic
1001714879 5:173807183-173807205 CCCCCAGACACTGGATTTGCCGG + Intergenic
1002319184 5:178364908-178364930 GCCCCAGGCACTGGAAATGCTGG - Intronic
1002883985 6:1277554-1277576 TCGCCAGGCATCAAATCTGCTGG + Intergenic
1003109897 6:3244780-3244802 TCACCAGACATGGAATCTGCGGG - Intronic
1003300517 6:4877048-4877070 TCGCCAGACACTGAATCTGCTGG + Intronic
1003527771 6:6912194-6912216 TCACCAGACACTGCATCTGCCGG + Intergenic
1003947686 6:11090320-11090342 TCACCAGACATTGAATCTGCTGG + Intergenic
1003985487 6:11430779-11430801 TTACCAGGCACTGAATCTGCTGG + Intergenic
1004038507 6:11949858-11949880 TCGCCAGACACTGAATCTGCCGG + Intergenic
1004371805 6:15059284-15059306 TCGCCAGACATCGAATCTGCTGG - Intergenic
1004756996 6:18621078-18621100 TCACCAGACATTGAATCTGTTGG + Intergenic
1005610676 6:27521346-27521368 TCACCAGACATTGAATCAGCTGG - Intergenic
1006034422 6:31200378-31200400 TCACCAGGAACTGAATCTGCTGG + Intronic
1006796514 6:36735663-36735685 TCCCCAGGCTGGGGCTCTGCAGG + Intergenic
1006810215 6:36815529-36815551 TCACCAGACATTGAATTTGCTGG + Intronic
1006826238 6:36938397-36938419 TCACCAGACATCGCATCTGCTGG - Intergenic
1007036066 6:38674880-38674902 TCACCAGACACTGGATCTGCTGG + Intergenic
1007301360 6:40870304-40870326 TCCCCACCAAATGGATCTGCTGG - Intergenic
1008939837 6:57034704-57034726 TCACCAGACACTGAATCTGCTGG + Intergenic
1009868140 6:69423535-69423557 TCCCCAGACATCAAATCTGCTGG - Intergenic
1010464048 6:76146015-76146037 TTCCCAGTCATTGGTTCTGCTGG - Intergenic
1010470171 6:76217814-76217836 TCACCAGACACTGAATCTGCTGG - Intergenic
1010986978 6:82435762-82435784 TCACCAGACACTGAATCTGCTGG + Intergenic
1011752539 6:90467993-90468015 ACCCCAGGTATTGGTTCTGTAGG - Intergenic
1011805467 6:91067922-91067944 TCACCAGACACTGAATCTGCTGG + Intergenic
1012357477 6:98333574-98333596 TCACCAGACACTGAATCTGCTGG - Intergenic
1012986012 6:105877187-105877209 TCACCAGACACTGAATCTGCTGG - Intergenic
1013182339 6:107728754-107728776 TACCCAGGCAAAGGATGTGCTGG + Intronic
1013446854 6:110237962-110237984 TCATCAGACATTGAATCTGCTGG - Intronic
1013805229 6:113989357-113989379 TCACCAGACACTGAATCTGCTGG - Intronic
1014394045 6:120902044-120902066 TCACTAGACACTGGATCTGCTGG + Intergenic
1014666970 6:124250183-124250205 TCACCAAACATTAGATCTGCTGG + Intronic
1014774909 6:125497477-125497499 TCACCAGACACTGAATCTGCTGG + Intergenic
1015500523 6:133927962-133927984 TCACCAGGCACTGGATCTGCTGG + Intergenic
1015674945 6:135735473-135735495 TCCCCAGACACTGAATCTGCTGG + Intergenic
1015758008 6:136627707-136627729 TCACCAGACACTGAATCTGCTGG + Intronic
1015807424 6:137125181-137125203 TCACCAAACACTGGATCTGCTGG - Intergenic
1016301082 6:142632618-142632640 TCACCAGACACTGAATCTGCCGG + Intergenic
1016870236 6:148808904-148808926 TCACCAGGAATTGAATCTGCTGG + Intronic
1017429608 6:154358193-154358215 TCACCAGACAATGAATCTGCTGG + Intronic
1017515260 6:155150709-155150731 TCACCAGACACTGAATCTGCCGG - Intronic
1017792890 6:157817079-157817101 TCACCAGACACTGAATCTGCTGG + Intronic
1018105533 6:160482795-160482817 TCCCAAGGCCTTGGCTCTGTTGG + Intergenic
1018782181 6:167078233-167078255 TCACCAGACATCGAATCTGCCGG - Intergenic
1018791367 6:167150583-167150605 TCACCAGACACTGGATCTGCTGG + Intronic
1020412729 7:7911301-7911323 TCACCAGACACTGAATCTGCTGG - Intronic
1020468181 7:8504857-8504879 TCACCAGACACCGGATCTGCTGG + Intronic
1021080821 7:16362287-16362309 TCCCCAGACATCAAATCTGCTGG - Intronic
1021293170 7:18870795-18870817 TCCCGAGTCATTGGAACTACAGG + Intronic
1021477467 7:21078855-21078877 TCACCAGACACTGAATCTGCTGG + Intergenic
1021525375 7:21580591-21580613 TCCCCAGACACTGAACCTGCGGG - Intronic
1022391472 7:29947924-29947946 TCCCCAGACACTGGGTCTTCCGG + Intronic
1022459080 7:30587039-30587061 TCCACAGGCCTTGGTTCTGCAGG + Intergenic
1023184616 7:37520014-37520036 TCACCAGACACTGGATTTGCTGG + Intergenic
1023416088 7:39934168-39934190 TCACCAGACACTGCATCTGCTGG + Intergenic
1023895976 7:44433130-44433152 TCCCCAGACACTGAATCTTCTGG + Intronic
1024012698 7:45283578-45283600 TCCTCAGACATTGGAGCTCCTGG - Intergenic
1024481987 7:49873275-49873297 TCACCAGGCACTGAATCTGCAGG - Intronic
1024595110 7:50926278-50926300 TCACCAGACACTGAATCTGCTGG - Intergenic
1024658244 7:51470550-51470572 TCCCCTGGCAATGGATGTGAGGG + Intergenic
1024683503 7:51719150-51719172 TCGCCAGACACTGGATCTGCAGG - Intergenic
1024693287 7:51826611-51826633 TCACCTGTGATTGGATCTGCTGG + Intergenic
1025184687 7:56848554-56848576 ACCCCAGGCATTAGATCATCAGG + Intergenic
1025687243 7:63728408-63728430 ACCCCAGGCATTAGATCATCAGG - Intergenic
1025713167 7:63930463-63930485 TGCCCTGGCATTGCATCTACAGG + Intergenic
1026346805 7:69481586-69481608 CCCCCACACAATGGATCTGCTGG + Intergenic
1026658363 7:72276975-72276997 TCCCCAGACATCAAATCTGCTGG + Intronic
1026658382 7:72277146-72277168 TCCCCAGACATCAAATCTGCTGG + Intronic
1026965423 7:74436242-74436264 TCCCCAGGCAGTGAACCTGCTGG - Intergenic
1027447105 7:78286741-78286763 GCCCCAAGCATTGGTTCTGAAGG + Intronic
1027457926 7:78416873-78416895 TCACCAGACACTGAATCTGCTGG + Intronic
1027547207 7:79542511-79542533 TCACCAGACATTGAATCTGCTGG + Intergenic
1027930563 7:84528749-84528771 TTCTCAGGCATTTGATCTTCAGG + Intergenic
1028629075 7:92913903-92913925 TCACCAGACACTGAATCTGCTGG + Intergenic
1028777067 7:94689279-94689301 TCACCAGACACTGAATCTGCTGG - Intergenic
1029204342 7:98859943-98859965 TCCCCAGTAACTGGAACTGCAGG - Intronic
1029601565 7:101566568-101566590 TCACCAGGAACCGGATCTGCTGG - Intergenic
1029804421 7:102981635-102981657 TCACCAGACACTGAATCTGCTGG - Intronic
1030099892 7:105936487-105936509 TCTCCAGGTACTGAATCTGCTGG + Intronic
1031016160 7:116578878-116578900 TCGCCAGACACTGAATCTGCTGG - Intergenic
1031206472 7:118764478-118764500 TCACCAGACACTGTATCTGCTGG - Intergenic
1031461969 7:122062552-122062574 TCACCAGACATCGAATCTGCGGG + Intergenic
1031559489 7:123220961-123220983 TCACCAGACACTGGATCTCCTGG + Intergenic
1031582351 7:123492116-123492138 TCCCCAGACACTGAGTCTGCTGG + Intronic
1031642173 7:124178669-124178691 TCAACAGACATTGAATCTGCTGG + Intergenic
1031713039 7:125073108-125073130 TCCCCAAGTGTTTGATCTGCTGG - Intergenic
1031914444 7:127549766-127549788 TCACCAGACATTAGATCTGCTGG - Intergenic
1032073572 7:128825078-128825100 TCGCCAGACATGGAATCTGCAGG + Intergenic
1032881303 7:136093366-136093388 TCACCAGACACTGGATATGCTGG - Intergenic
1032973991 7:137200800-137200822 TCGCCAGACACTGAATCTGCCGG + Intergenic
1033018659 7:137699084-137699106 TCACCGGACATTGAATCTGCTGG - Intronic
1033137746 7:138798719-138798741 TCCCCGGGCACTGGAAATGCTGG + Intronic
1033706627 7:143892883-143892905 TCACCAGACATTAAATCTGCTGG + Intronic
1033919827 7:146376952-146376974 TCCCCAGACATTAAACCTGCAGG + Intronic
1034232068 7:149538172-149538194 TCACCAGACATGGAATCTGCTGG + Intergenic
1034716456 7:153247112-153247134 TCACCAGACACTGAATCTGCTGG + Intergenic
1035003695 7:155638880-155638902 TCACCAGACACTGAATCTGCTGG - Intronic
1035212025 7:157336091-157336113 TCCTTAGGCTTTGGGTCTGCGGG + Intronic
1035990788 8:4488122-4488144 TCCCCAGACATCGAATTTGCTGG + Intronic
1036083958 8:5592229-5592251 TTCCCAGGCAGAGGATCCGCAGG - Intergenic
1036152196 8:6309025-6309047 TACCCTGGCATTGGCTCTACAGG + Intergenic
1036161783 8:6395790-6395812 TCACCAGACACTGAATCTGCTGG - Intergenic
1036571499 8:9983515-9983537 TCACCAGACACTGGATCTGCGGG + Intergenic
1036684808 8:10902620-10902642 TGCCCAGCCATTGGCTCTTCAGG + Intronic
1037586923 8:20283403-20283425 TCCCCAGACACTGAATCTGCTGG + Intronic
1037827964 8:22170635-22170657 TTCACAGGCATTGTACCTGCAGG - Intronic
1038394313 8:27235837-27235859 TCACCAGACACTGAATCTGCTGG + Exonic
1038532239 8:28327873-28327895 TCACCAGACACTGAATCTGCAGG - Intronic
1038707529 8:29908926-29908948 TCTGCAGACTTTGGATCTGCTGG - Intergenic
1038821370 8:30955127-30955149 TCACCAGACATGGAATCTGCTGG - Intergenic
1039137487 8:34341921-34341943 TCACCAGACACTGGATCTGCTGG + Intergenic
1039509728 8:38081363-38081385 CCCCCACCCAATGGATCTGCTGG + Intergenic
1039806770 8:41006578-41006600 TCACCAGGCACCGAATCTGCCGG + Intergenic
1039877848 8:41602822-41602844 TCACCAGACACTGAATCTGCTGG - Intronic
1040436085 8:47393122-47393144 TCAACAGGCAGTGGCTCTGCAGG - Intronic
1041129942 8:54687821-54687843 TGCCCAGGAATGGGATTTGCTGG + Intergenic
1041130890 8:54698518-54698540 TACCCAGGAATGGGATTTGCTGG - Intergenic
1041257619 8:55992751-55992773 TCGCCAGGCACTGTATCTACTGG - Intronic
1042210164 8:66372123-66372145 TCACCAGACACTGAATCTGCTGG - Intergenic
1042225308 8:66510673-66510695 TCGCCAGTCACTGAATCTGCTGG - Intronic
1042429661 8:68690496-68690518 TCCCTAGACATTGAATCTCCTGG - Intronic
1042474679 8:69233728-69233750 TCACCAGACATTGAATCTGCTGG - Intergenic
1042990273 8:74631760-74631782 TCACCAGACACTGAATCTGCTGG - Intronic
1043011638 8:74888439-74888461 TCACCAGACACTGAATCTGCTGG - Intergenic
1043585623 8:81766037-81766059 TCCCCAGACACTGAATCTGCTGG + Intergenic
1043715633 8:83482025-83482047 TCACCAGACACTGGATCTGCTGG + Intergenic
1044620457 8:94186412-94186434 TCACCAGACACTGAATCTGCTGG - Intronic
1044639615 8:94365047-94365069 TCACCAGACACTGGCTCTGCTGG + Intergenic
1045033663 8:98161340-98161362 TCCCCAGGCCTCAGATCGGCTGG - Intergenic
1045727752 8:105195612-105195634 ACCCCAGGCTTTGTATGTGCAGG + Intronic
1045953757 8:107882762-107882784 TCCCCAGACAATGGAGCTACAGG - Intergenic
1046152073 8:110240668-110240690 TTACCAGGCATTGAATCTACTGG - Intergenic
1046902367 8:119536945-119536967 TTGCCAGACATTGAATCTGCTGG + Intergenic
1047617360 8:126573716-126573738 TCACCAGACAGTGAATCTGCTGG + Intergenic
1047824843 8:128562125-128562147 TCACCAGACAGTGAATCTGCTGG + Intergenic
1048039914 8:130717235-130717257 TCACCAGACACTGAATCTGCAGG + Intergenic
1048265905 8:132985707-132985729 TCCCCAGGCCTTTGATGAGCAGG - Intronic
1048929032 8:139296252-139296274 TCACCAGACACTGAATCTGCTGG + Intergenic
1050093650 9:2041363-2041385 TCACCAGACACTGAATCTGCTGG - Intronic
1050103930 9:2146130-2146152 TCACCAGACATGGAATCTGCTGG - Intronic
1050205244 9:3189280-3189302 GCACCAGACACTGGATCTGCCGG + Intergenic
1050692676 9:8245689-8245711 GCCCCAGGCATTCTATCTGCTGG + Intergenic
1050755404 9:8996619-8996641 TCACCAGACACTGAATCTGCTGG - Intronic
1051229394 9:14939607-14939629 TCCCTAGGTCTTGAATCTGCTGG + Intergenic
1051277270 9:15408881-15408903 TCACCAGACATGGAATCTGCAGG - Intergenic
1051519968 9:17975375-17975397 TCACCAGACATTAAATCTGCTGG - Intergenic
1053282589 9:36830697-36830719 TCCACAGCTATTGGATCTGCGGG + Intergenic
1053359506 9:37474288-37474310 TCACCAGGAACTGAATCTGCTGG + Intergenic
1053722503 9:40961206-40961228 TCACCAGACACTGGTTCTGCTGG + Intergenic
1054343466 9:63890792-63890814 TCACCAGACACTGGTTCTGCTGG - Intergenic
1056315489 9:85385596-85385618 TCACCAGACATGGAATCTGCTGG - Intergenic
1056591541 9:87969241-87969263 TCCCCAGGCATTGGATCTGCTGG - Exonic
1056789337 9:89615589-89615611 TCACCAGACATTGAACCTGCTGG + Intergenic
1056941824 9:90962521-90962543 TTCCCTGACACTGGATCTGCTGG - Intergenic
1057807812 9:98233178-98233200 TCACCACACATTGAATCTGCCGG + Intronic
1057811528 9:98260770-98260792 TCACCAGACACTGAATCTGCTGG - Intergenic
1058238768 9:102528906-102528928 TCCTCAGACACTGAATCTGCTGG - Intergenic
1058339524 9:103877711-103877733 TCACCAAGGATTGAATCTGCTGG - Intergenic
1058536048 9:105961251-105961273 TCACCAGACACTAGATCTGCTGG + Intergenic
1058608384 9:106748352-106748374 TCACCAGGCACTGAATCTGTGGG - Intergenic
1058827593 9:108788687-108788709 TCACCAGACATTGACTCTGCGGG - Intergenic
1059507707 9:114814703-114814725 TCACCAGACACTGAATCTGCTGG - Intergenic
1060501104 9:124156541-124156563 TCACCACACACTGGATCTGCTGG - Intergenic
1061223758 9:129267953-129267975 TCCCCAGACACTGAATCTGCTGG + Intergenic
1062109938 9:134776817-134776839 TCCGCAGACACTGCATCTGCTGG - Intronic
1062518075 9:136945922-136945944 CCCCCAGGGATGGGATCTGCTGG + Exonic
1062541124 9:137042008-137042030 TCCCCGGGCCTGGGCTCTGCAGG - Intronic
1203452672 Un_GL000219v1:134773-134795 TCACCAGACACTGGCTCTGCTGG - Intergenic
1185959247 X:4529498-4529520 TCACCAAACATTGAATCTGCTGG + Intergenic
1185970886 X:4662359-4662381 TCACCAGGCACTGAATCTGCTGG - Intergenic
1186146213 X:6626898-6626920 TCATCAGGCACTGAATCTGCTGG - Intergenic
1186160869 X:6775848-6775870 TCACCAGGCACTGGATCTGCTGG + Intergenic
1186173029 X:6897704-6897726 TCACCAGACATTGAATCTGCGGG - Intergenic
1186302850 X:8219314-8219336 TCACCAGGCACTGCATCTGGTGG - Intergenic
1186987062 X:15028543-15028565 TCACCAGACACTGAATCTGCTGG + Intergenic
1187280674 X:17856482-17856504 TCACCAGACACTGAATCTGCCGG + Intronic
1187796610 X:23010704-23010726 TCAACAGGCATTGTATCTGAGGG + Intergenic
1188228413 X:27630802-27630824 TCACCAGACATAGAATCTGCTGG - Intronic
1188391775 X:29630107-29630129 TCACCAGACACTGAATCTGCTGG - Intronic
1188870349 X:35364350-35364372 TCCACAGGTACAGGATCTGCAGG + Intergenic
1189124764 X:38434743-38434765 TCACCAGACACTGAATCTGCTGG - Intronic
1189548852 X:42072364-42072386 TCGCCAGGCACTGGATCTGCTGG + Intergenic
1189636893 X:43020567-43020589 TCACCAGACACTGAATCTGCTGG + Intergenic
1189774477 X:44458097-44458119 TCACCAGACACTGAATCTGCTGG - Intergenic
1190381943 X:49847625-49847647 TCACCAGACACAGGATCTGCTGG - Intergenic
1190451940 X:50590624-50590646 TCACAAGGCATTGAATCTGCTGG + Intergenic
1190721656 X:53153762-53153784 ACCACTGTCATTGGATCTGCTGG + Intergenic
1191663283 X:63672205-63672227 TCACCAGGCACTGAATCTACTGG + Intronic
1192272183 X:69591382-69591404 TCACCAGACACTGAATCTGCTGG + Intergenic
1192479283 X:71470893-71470915 TCCCCAGGAATTGGAACCACAGG - Intronic
1192705077 X:73520726-73520748 TCACCAGGCACTGAATCTGCTGG - Intergenic
1192846675 X:74912936-74912958 TCCCCAGGAATTGGAGGTCCTGG + Intronic
1193458982 X:81767500-81767522 TCAGCAGACATTGAATCTGCTGG - Intergenic
1193869193 X:86776252-86776274 TCACCAGACATGGAATCTGCCGG - Intronic
1194895959 X:99440102-99440124 TCATCAGGGATTTGATCTGCAGG - Intergenic
1195377439 X:104241497-104241519 ACCACAGGCACTGGAACTGCAGG - Intergenic
1195430331 X:104782044-104782066 TCACCAGACACTGAATCTGCTGG + Intronic
1195857123 X:109343497-109343519 TTGCCAGGCATTGGCTCTGTGGG + Intergenic
1195987622 X:110647371-110647393 TCACCAGACACTGAATCTGCTGG + Intergenic
1196939082 X:120758121-120758143 TCACCAGACACTGGATCTGCTGG + Intergenic
1196964314 X:121039078-121039100 TCACCAGACACTGAATCTGCTGG - Intergenic
1197521979 X:127510224-127510246 TCACATAGCATTGGATCTGCTGG - Intergenic
1197925413 X:131642219-131642241 TCAGCAGACACTGGATCTGCTGG - Intergenic
1198070223 X:133140820-133140842 TCCCAAAGCATTGGGTTTGCAGG - Intergenic
1198300806 X:135332519-135332541 TCTCCAGGAACTGAATCTGCTGG + Intronic
1198499182 X:137225668-137225690 TCACCAGACACTGAATCTGCTGG + Intergenic
1199116774 X:144001458-144001480 TCACCAGACATTGAATCTGCTGG - Intergenic
1199657164 X:150007527-150007549 TCCTCATGCATTAGCTCTGCTGG - Intergenic
1199695068 X:150338136-150338158 TCACCAGGAACTGAATCTGCTGG - Intergenic
1199742415 X:150748004-150748026 TCACCAGACACTGAATCTGCTGG - Intronic
1199845041 X:151686683-151686705 TCACCAGACACTGAATCTGCTGG - Intergenic
1200167798 X:154049380-154049402 TCTCCTGGCATTGGGGCTGCAGG - Intronic
1200238793 X:154482957-154482979 TTCCCTGGCAATGGATCAGCTGG - Intergenic
1201554135 Y:15250905-15250927 TCACCAGGCACTGGATCTGCTGG + Intergenic