ID: 1056592178

View in Genome Browser
Species Human (GRCh38)
Location 9:87972638-87972660
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056592170_1056592178 16 Left 1056592170 9:87972599-87972621 CCGATGACTTAACTTACACTTTT 0: 1
1: 0
2: 0
3: 22
4: 239
Right 1056592178 9:87972638-87972660 CTGTGGCTATGGAGAGCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr