ID: 1056593403

View in Genome Browser
Species Human (GRCh38)
Location 9:87984155-87984177
Sequence CCTACGGGTGGTGTTGGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056593403_1056593411 -8 Left 1056593403 9:87984155-87984177 CCAACCCCAACACCACCCGTAGG No data
Right 1056593411 9:87984170-87984192 CCCGTAGGGTACCCAAAGTCCGG 0: 9
1: 12
2: 9
3: 12
4: 41
1056593403_1056593416 4 Left 1056593403 9:87984155-87984177 CCAACCCCAACACCACCCGTAGG No data
Right 1056593416 9:87984182-87984204 CCAAAGTCCGGTGGTGACAAAGG No data
1056593403_1056593413 -5 Left 1056593403 9:87984155-87984177 CCAACCCCAACACCACCCGTAGG No data
Right 1056593413 9:87984173-87984195 GTAGGGTACCCAAAGTCCGGTGG 0: 10
1: 11
2: 17
3: 15
4: 48
1056593403_1056593418 20 Left 1056593403 9:87984155-87984177 CCAACCCCAACACCACCCGTAGG No data
Right 1056593418 9:87984198-87984220 ACAAAGGAATGAGAAGAGACAGG 0: 23
1: 18
2: 19
3: 67
4: 652

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056593403 Original CRISPR CCTACGGGTGGTGTTGGGGT TGG (reversed) Intergenic
No off target data available for this crispr