ID: 1056598856

View in Genome Browser
Species Human (GRCh38)
Location 9:88030299-88030321
Sequence TATCCATGAGCCACCTCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056598850_1056598856 11 Left 1056598850 9:88030265-88030287 CCTACTGCCTCAGCCTCCCAAAG 0: 259
1: 27745
2: 81088
3: 162320
4: 170281
Right 1056598856 9:88030299-88030321 TATCCATGAGCCACCTCCCCTGG No data
1056598855_1056598856 -6 Left 1056598855 9:88030282-88030304 CCAAAGTGCTAGGATTATATCCA No data
Right 1056598856 9:88030299-88030321 TATCCATGAGCCACCTCCCCTGG No data
1056598849_1056598856 27 Left 1056598849 9:88030249-88030271 CCTGTGCTGAAGCGATCCTACTG No data
Right 1056598856 9:88030299-88030321 TATCCATGAGCCACCTCCCCTGG No data
1056598853_1056598856 -2 Left 1056598853 9:88030278-88030300 CCTCCCAAAGTGCTAGGATTATA 0: 2529
1: 52066
2: 341755
3: 245650
4: 128975
Right 1056598856 9:88030299-88030321 TATCCATGAGCCACCTCCCCTGG No data
1056598851_1056598856 4 Left 1056598851 9:88030272-88030294 CCTCAGCCTCCCAAAGTGCTAGG 0: 7161
1: 100627
2: 219432
3: 239748
4: 262231
Right 1056598856 9:88030299-88030321 TATCCATGAGCCACCTCCCCTGG No data
1056598854_1056598856 -5 Left 1056598854 9:88030281-88030303 CCCAAAGTGCTAGGATTATATCC No data
Right 1056598856 9:88030299-88030321 TATCCATGAGCCACCTCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056598856 Original CRISPR TATCCATGAGCCACCTCCCC TGG Intergenic
No off target data available for this crispr