ID: 1056599689

View in Genome Browser
Species Human (GRCh38)
Location 9:88036949-88036971
Sequence CCTCTCCAAACATAGCTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056599689_1056599701 12 Left 1056599689 9:88036949-88036971 CCAGTGAGCTATGTTTGGAGAGG No data
Right 1056599701 9:88036984-88037006 GGGGCTGGGGAAGGTGGTGTTGG No data
1056599689_1056599705 25 Left 1056599689 9:88036949-88036971 CCAGTGAGCTATGTTTGGAGAGG No data
Right 1056599705 9:88036997-88037019 GTGGTGTTGGATCCTGTTGGGGG No data
1056599689_1056599699 3 Left 1056599689 9:88036949-88036971 CCAGTGAGCTATGTTTGGAGAGG No data
Right 1056599699 9:88036975-88036997 CTCTGGGCAGGGGCTGGGGAAGG No data
1056599689_1056599695 -7 Left 1056599689 9:88036949-88036971 CCAGTGAGCTATGTTTGGAGAGG No data
Right 1056599695 9:88036965-88036987 GGAGAGGAAGCTCTGGGCAGGGG No data
1056599689_1056599698 -1 Left 1056599689 9:88036949-88036971 CCAGTGAGCTATGTTTGGAGAGG No data
Right 1056599698 9:88036971-88036993 GAAGCTCTGGGCAGGGGCTGGGG No data
1056599689_1056599703 23 Left 1056599689 9:88036949-88036971 CCAGTGAGCTATGTTTGGAGAGG No data
Right 1056599703 9:88036995-88037017 AGGTGGTGTTGGATCCTGTTGGG No data
1056599689_1056599696 -3 Left 1056599689 9:88036949-88036971 CCAGTGAGCTATGTTTGGAGAGG No data
Right 1056599696 9:88036969-88036991 AGGAAGCTCTGGGCAGGGGCTGG No data
1056599689_1056599694 -8 Left 1056599689 9:88036949-88036971 CCAGTGAGCTATGTTTGGAGAGG No data
Right 1056599694 9:88036964-88036986 TGGAGAGGAAGCTCTGGGCAGGG No data
1056599689_1056599693 -9 Left 1056599689 9:88036949-88036971 CCAGTGAGCTATGTTTGGAGAGG No data
Right 1056599693 9:88036963-88036985 TTGGAGAGGAAGCTCTGGGCAGG No data
1056599689_1056599702 22 Left 1056599689 9:88036949-88036971 CCAGTGAGCTATGTTTGGAGAGG No data
Right 1056599702 9:88036994-88037016 AAGGTGGTGTTGGATCCTGTTGG No data
1056599689_1056599704 24 Left 1056599689 9:88036949-88036971 CCAGTGAGCTATGTTTGGAGAGG No data
Right 1056599704 9:88036996-88037018 GGTGGTGTTGGATCCTGTTGGGG No data
1056599689_1056599697 -2 Left 1056599689 9:88036949-88036971 CCAGTGAGCTATGTTTGGAGAGG No data
Right 1056599697 9:88036970-88036992 GGAAGCTCTGGGCAGGGGCTGGG No data
1056599689_1056599706 30 Left 1056599689 9:88036949-88036971 CCAGTGAGCTATGTTTGGAGAGG No data
Right 1056599706 9:88037002-88037024 GTTGGATCCTGTTGGGGGACAGG No data
1056599689_1056599700 6 Left 1056599689 9:88036949-88036971 CCAGTGAGCTATGTTTGGAGAGG No data
Right 1056599700 9:88036978-88037000 TGGGCAGGGGCTGGGGAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056599689 Original CRISPR CCTCTCCAAACATAGCTCAC TGG (reversed) Intergenic