ID: 1056599705

View in Genome Browser
Species Human (GRCh38)
Location 9:88036997-88037019
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056599689_1056599705 25 Left 1056599689 9:88036949-88036971 CCAGTGAGCTATGTTTGGAGAGG No data
Right 1056599705 9:88036997-88037019 GTGGTGTTGGATCCTGTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056599705 Original CRISPR GTGGTGTTGGATCCTGTTGG GGG Intergenic
No off target data available for this crispr