ID: 1056604686

View in Genome Browser
Species Human (GRCh38)
Location 9:88076791-88076813
Sequence GGGCCCTGGAAGCTCCAGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056604686_1056604695 6 Left 1056604686 9:88076791-88076813 CCCGCCTGGAGCTTCCAGGGCCC No data
Right 1056604695 9:88076820-88076842 GGGCCCCTGCATCTCCCGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056604686 Original CRISPR GGGCCCTGGAAGCTCCAGGC GGG (reversed) Intergenic
No off target data available for this crispr