ID: 1056604965

View in Genome Browser
Species Human (GRCh38)
Location 9:88077988-88078010
Sequence CTCCAAATGCAGTCACACTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056604958_1056604965 14 Left 1056604958 9:88077951-88077973 CCTCACTTAACCTTTATTACCTC No data
Right 1056604965 9:88077988-88078010 CTCCAAATGCAGTCACACTAGGG No data
1056604955_1056604965 25 Left 1056604955 9:88077940-88077962 CCACCCTATGACCTCACTTAACC No data
Right 1056604965 9:88077988-88078010 CTCCAAATGCAGTCACACTAGGG No data
1056604956_1056604965 22 Left 1056604956 9:88077943-88077965 CCCTATGACCTCACTTAACCTTT 0: 6
1: 31
2: 231
3: 599
4: 1183
Right 1056604965 9:88077988-88078010 CTCCAAATGCAGTCACACTAGGG No data
1056604954_1056604965 26 Left 1056604954 9:88077939-88077961 CCCACCCTATGACCTCACTTAAC No data
Right 1056604965 9:88077988-88078010 CTCCAAATGCAGTCACACTAGGG No data
1056604960_1056604965 4 Left 1056604960 9:88077961-88077983 CCTTTATTACCTCCTTATAGGTT No data
Right 1056604965 9:88077988-88078010 CTCCAAATGCAGTCACACTAGGG No data
1056604961_1056604965 -5 Left 1056604961 9:88077970-88077992 CCTCCTTATAGGTTCTGCCTCCA No data
Right 1056604965 9:88077988-88078010 CTCCAAATGCAGTCACACTAGGG No data
1056604957_1056604965 21 Left 1056604957 9:88077944-88077966 CCTATGACCTCACTTAACCTTTA No data
Right 1056604965 9:88077988-88078010 CTCCAAATGCAGTCACACTAGGG No data
1056604962_1056604965 -8 Left 1056604962 9:88077973-88077995 CCTTATAGGTTCTGCCTCCAAAT No data
Right 1056604965 9:88077988-88078010 CTCCAAATGCAGTCACACTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056604965 Original CRISPR CTCCAAATGCAGTCACACTA GGG Intergenic
No off target data available for this crispr