ID: 1056606848

View in Genome Browser
Species Human (GRCh38)
Location 9:88093025-88093047
Sequence GTTTTTAAGGGGATTTGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056606848_1056606856 9 Left 1056606848 9:88093025-88093047 CCTCCACAAATCCCCTTAAAAAC No data
Right 1056606856 9:88093057-88093079 GAACCCCTCAATGAAATGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056606848 Original CRISPR GTTTTTAAGGGGATTTGTGG AGG (reversed) Intergenic
No off target data available for this crispr