ID: 1056606856

View in Genome Browser
Species Human (GRCh38)
Location 9:88093057-88093079
Sequence GAACCCCTCAATGAAATGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056606842_1056606856 29 Left 1056606842 9:88093005-88093027 CCAAATTTCCCAGCCCCTCACCT No data
Right 1056606856 9:88093057-88093079 GAACCCCTCAATGAAATGAGAGG No data
1056606845_1056606856 16 Left 1056606845 9:88093018-88093040 CCCCTCACCTCCACAAATCCCCT No data
Right 1056606856 9:88093057-88093079 GAACCCCTCAATGAAATGAGAGG No data
1056606849_1056606856 6 Left 1056606849 9:88093028-88093050 CCACAAATCCCCTTAAAAACCTT No data
Right 1056606856 9:88093057-88093079 GAACCCCTCAATGAAATGAGAGG No data
1056606844_1056606856 20 Left 1056606844 9:88093014-88093036 CCAGCCCCTCACCTCCACAAATC No data
Right 1056606856 9:88093057-88093079 GAACCCCTCAATGAAATGAGAGG No data
1056606846_1056606856 15 Left 1056606846 9:88093019-88093041 CCCTCACCTCCACAAATCCCCTT No data
Right 1056606856 9:88093057-88093079 GAACCCCTCAATGAAATGAGAGG No data
1056606852_1056606856 -4 Left 1056606852 9:88093038-88093060 CCTTAAAAACCTTTGCCCAGAAC No data
Right 1056606856 9:88093057-88093079 GAACCCCTCAATGAAATGAGAGG No data
1056606850_1056606856 -2 Left 1056606850 9:88093036-88093058 CCCCTTAAAAACCTTTGCCCAGA No data
Right 1056606856 9:88093057-88093079 GAACCCCTCAATGAAATGAGAGG No data
1056606851_1056606856 -3 Left 1056606851 9:88093037-88093059 CCCTTAAAAACCTTTGCCCAGAA No data
Right 1056606856 9:88093057-88093079 GAACCCCTCAATGAAATGAGAGG No data
1056606843_1056606856 21 Left 1056606843 9:88093013-88093035 CCCAGCCCCTCACCTCCACAAAT No data
Right 1056606856 9:88093057-88093079 GAACCCCTCAATGAAATGAGAGG No data
1056606848_1056606856 9 Left 1056606848 9:88093025-88093047 CCTCCACAAATCCCCTTAAAAAC No data
Right 1056606856 9:88093057-88093079 GAACCCCTCAATGAAATGAGAGG No data
1056606847_1056606856 14 Left 1056606847 9:88093020-88093042 CCTCACCTCCACAAATCCCCTTA No data
Right 1056606856 9:88093057-88093079 GAACCCCTCAATGAAATGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056606856 Original CRISPR GAACCCCTCAATGAAATGAG AGG Intergenic
No off target data available for this crispr